Homo_sapiens Locus Mono:165:AC010170.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:165:AC010170.3
Homo_sapiens
Mono:165:AC010170.3
3
SNORD3@L9
1001..1211
2211
TGGCCTTACAATAGATAATCCGCCCATATATATTTTTTCTTTTGGTCTTTAAAGCTAGA
GAAGGAAAAAAAAGTGACCTAAGAAAAAAAACGAAATCTAAATAGCCTTGTATCTATAAA
AGGATTGAATTTACGAATTTTTAAAAAGCTACCACAAAGAAAACTCCAGGCTCACTGGTG
AATTCTACCAAAAATTTAAAGAGAGCCAGCGTGGTGATTCATGCCTGTAATCCCAGCACT
TTGGAAGGCTGAGGCAGGAGGATCACTTGAGGCCAGGATTGTGAGACCAGCCTGGGCTAA
ACATAACAAGACCTTGTCTTTACAAAAAAGGTTTTTTTTGTTTTTTTTTTTTAATTAGCG
GTGTGTAGTGGTATGTATCTGCAGTTCTAGATACTTGAAAGGTTGAGGCTAGAGGACTGC
TTAAGCCCAGGAGGCTGAGGCTGCAGTGAGCCACGAACATGCCACTGCACTCCAATCTGG
GTGACAGAGCAAGACCCTGTCTCAAGAAAAAAAAAAAAAAGTAGGGAAGCAATAATGTGA
ATCTTACATAAACTCTTTCAAAAAATAGAGGAGAAGGGATTTCATTGTATGAGGCTAGTA
TATCCCCAACATCAAAACCTGACAGAGACATTAAAAAAAATGCAGACTGATAGCCATCAT
GAACCTAGACAGAAAATCCTTTTTAAAAAATTGGTATATCAGCTGGGTGCAGTGGCTCAC
GCCTGTAATCCCAGCACTTCGGGAGGCCAAGGTGGGTGGATCACCTGAGGTCAGAAGTTC
AAGACCAGCCTGGCCAACATGGTGAAACCCCCTCTCTACTAGAAATACAAAAAATTAGCC
AGGTGTGGTGGCAGGTGCCTGTAATCCCAGCTACTCCAGAGGCTGAGGCAGGAGAATCAC
TTGAACCCAGGAGGTAGAGGTTGCAGTGAGCCAAGATAGCGCCACTTCTCTCCAGCCTGG
GCAACAAGAACAAAACTCCGCCCCCCTGCCCACCACCACAAAATTGTATACTTTCAGGGA
TCATTCCATAGGTTGTTACTAGAGAAGTTTTTTTAGATGTGTAGAACACTGGAAACCACG
AGGAGGAGGCGCAGCATTCTCTCTTGACCATGAAGCCGGCTCTTGGTGTTGTTTCATTGC
AACTGTCATTTGCCATTGATGATCGTTCTCTTCCTCTGGGAGAGTAAGAGGGAGAGGACA
CAGTTTGAGTGGTTCCCATTTTATTTAAAAAAAAAAGAAAAGATTTTTTTAAAAAATTGG
TAAATCAAATATAACAATGTGTAAAAGGATAACATATCATGGCCAAGTGCAAGATTTATT
TCACGTGAAAAAGTTAACCAATGTACTTATTAGTTATCTATTGCCATATAAAGGAATCAT
CTTCAAAATTTGGCATCCTAAAGCAATAAACATTTATTGTCTCACTGTTTCTGTGGGCAA
GAAATCCAAGTGATATTTAACTGGGTTATCCGGCACAGGGTCTGTCATGAGGCTGCCAAG
TGTAAGCTGAGGTGGTGGTCTCGTCTGAAGACTACACTGTGGGAGGGTCGGCTTCCAAGA
TCACTGCATCTTGCTGTTGGCAAGATCCAGTTCCTTGTGGCTGTTGGACTGAAGCCCTCA
GTTCTTTTCTGGTTTCTGGCCAAAGGCCTCCCTCAATTCCACGCCACGTGGACCTCTCCA
CAGTGCAGCTCACGACATGGTGGCTGACTCTTCTCAGAGCAAATGAGTAAAGGAAATCAC
ACAAAATGGAAGCCACAGTCTTTTTATAACTTAAATCTCAAGAGTGACATGCCACCATCC
CAGCCACATTGTATTTGTTATAAATGGGTCAGTAAATTCAGGTCATTCTCAAGGAGAGGG
AATTACACAGAGGCATGAATACCAGGAGGAGGGGATTACAGGAGACCATCTTGGGGGTGG
CCAGCTACGTAGTAATGCATCCCATTCACAGAGGAAAGGAGGAAACACGATCAGATCATG
AATGAAGAAAAAGTATTTGACAAATTCAACACTCATTCATAGTAAAAACTTCTGGTAAAT
TATGACTAGAAGGCAACTTTCTTAACCTTATAAAGAGCACCTATGAAACACTTAAAGCTA
ACATTATATGTAATGATGAAAGAATGAATGCTTTCCCCTAAGAGCAGGAAAAAGGCAGGG
ATGTCTGCTCTTACCACTTTTATTCACCATTTCCCTAGAGGTCATAGCAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved