Homo_sapiens Locus Mono:238:AL161640.23
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:238:AL161640.23
Homo_sapiens
Mono:238:AL161640.23
1
2128
CCCTCCATAGCTAGGGTGTGATGAGTGATATATACATTTAGTTAATTTAGCATAAAACT
GACCTTAGCCCTGGCTGCCAGGGAGAGACGGAACCAAAACTAAAGCAGCCTTCGAATCCT
CCAAACCAACCTCTCTCTGACTCCTAGAACATGGCGCCCTTTCTTGCTTCTCTTCCCCAT
AGCCAAAAAGGGACCAGAGCTCCCCACAGTGGGGCTTGTAGGAGCCTGAACAGAGCAGAG
GCACGCAGACTTGCAACTGAAGACTTAGAGCAGAGTCTGCAGAGCACAAACAGGACAGAG
GACCAGAAATCCATTACCACTGGAAGTGGTGGGGTTGGGTTCCACCAAGTAGGGGTCTGG
AGAGGGGTCTCTGAAGCTTGAGGGTGTTAAATAGTCATTTAAAGAAGATTGGCCAGGCGC
TGTGGTTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATTGCTTTGAG
TTCAGGAGTTCAAGACCAGCCTGGGCAACATGGCAAAACCCCGTCTCTACTAAAAATACA
AAACTTAGCCAGGTGTGGTGGCATGTGCCTATAGTCCCAGCTACTCGGGAGGCTGAGGCT
GGAGAATCTCTTAAACCCAGGGGGCAGAGGCTGCAGTGAGCCGAGATCATGCCACTGCAC
TCCAGCCTGGACGACAGAACGAGTCTCCATCTGGTTAAAAAAAAAAAAAAAAAAAAAAAA
ACAAAAAAAAAACTATCAGAGGAACTCTATCCACAGAAGACCTGAGTGGGAAGGCTGTGT
GAGAGGAAGAGCAGGTGAGGTTAAGTCACCTTCCCAGAACTCTGATGCTTCCTGCTTTGG
GATAAATAATAAGACCCCACATATATTATATCACAGACTCAAGGAGACTTTGCACATTGC
TTCATTTAACCCTCACAATGAATTTAAGAAACAGGTACTATTATTATTCCCATTCTACAG
ATGAGGAGACTGAGGTTTAGAGACATCAAAGAACTTATCCATTGTCAGGTGGGATAATCC
TTACCTATGTTTGGAGGACAGTATTAGGACATAATGATTGGAGTCACATGATATGATTAA
TGTCTGCTTCATAATCAGGTCTCACACACCCTGATTGCTCCTATCTGATTCTTCCTGACA
ATCTCTTAAAGAACAAAACGTAGGCCGGGCGCCGTGGCTCACGCTTGTAATCCCAGCACT
TTGGGAGGCTGAGGCGGGCGGATCATGAGGTCAGGAGATCGAGACCATCCTGGCTAACAT
GGTGAAACCCCATCTCTACAAAAAATACAAAAAATTAGCCGAGCGTGGTGGCAGGCGCCT
GTAGTCCCAGCTACTGGGGAGGCTGAGGCAGGAGAATGGCATGAACCCGGGAGGCGGAGC
TTGCAGTGAGCCGAGATTGTGCCACTGAACTCCAGCCTGGGCGACAGAGTGAGACACTTT
TTCTCAAAAAAAAAAAAAAAAAAGATAAATAAAAGAACAAAATGTATTTCCAAGGACACA
CAGCTAAGCTATGGTGGAGCTGGGATTTGAAAGCAGTCAGGCCTTTAGCCATGACACTGT
TCTATGTCCACTTAGCAGAATCTTTCAAAACACAAAGAACTGCTGCTAACATGCTCCTAA
GACTACCCAAGAAGCTGTTAAGTGAGTCTTGCCCTACCCGCACCGCCCTCTGTCTCTTCC
CATGCCAGAAGGTGGAAGACCACAGTGACTGATCAGATGGCAGCAGCACCCACCTGTGAC
CCAGCAATCAGAATCAAGTCCCACCACTGTTGCAGGCTGAGCCTGAGCAAAGCAGTCCCT
GCCACAAGGAGAACTGCTTCTTGCCTACTTTCTCCTGCTTTACCTTAAATCCCCCTAAAC
TCTGCACCTGTAAAAGCATCTCAAGACACATCACCCTTCTGATTGGGACTTTGATGTGGT
TACCATACGCCCTCTGACTGCTTCTTTCTGTTTTTTTTTATCCAGGTCTGTCTGTGCGGA
CCCTCTGTCCTGGCTGAACAGCATTTGTGGGGTCCCTGTGTTTGCTCAACATCCCAAAGC
CCCCTTAATTTTAGATCCGCTGAGCTCTGCTCTTTCTCTATCCTGCCTGGCCAGCCCCAC
CTCATGGCTGCTAGCCTCAGCATTCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved