Homo_sapiens Locus Mono:138:AL161448.16
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:138:AL161448.16
Homo_sapiens
Mono:138:AL161448.16
9
SNORD118L5
1001..1134
2134
CAGCACATACTTCCTCCCCTCTGAGGCATGTAAAAACCCCAGACTCAGCCAGACTTGCA
CAGATGACCTGTCTGCAGAGAGGAGCTACCCACTGTGGGTCTTCTCTCTGCTGAGAGCTG
GACACTTGTTGGGATGACCTGCCTGCAGACAGCTACCCACTGCGGGTCTCCTCTGAGCTG
TTCTATCACTCAATAAAGCACTTCTTCACCTTGCTACCCTCCACTTGTCTGCATACCTCA
TTCTTTCTGGATGCAGGACAAGAACTTGGGACCTGCTGAGTGGCAGGGCTGAAAGAACTG
TAACACAGACAGGACTGAAACATGTCCTTTGCTTGCCACATTGCGGAAGATGAGAGGGAG
AGAAGAGAGAAGGAGAGAAGAGTTTCAGCCCTTTGGGGATCCCAGACCTACGAGCTCCTT
GAGCCAGGGCTGTGACACCCTTTTTGGAGTTCTGCAGTTCTTGGAGTCTCCAAGCTTCCA
GGCACCACCATGTTCCCCAGTGCCAGCCATAGAAACTGCTTGCAGTACGCCTGGTCCAGC
TGTAGCCTCGCAGGGAACCGGCACCCATGCCAGTGCCTGGAGCTGCCTGCCCTGCCGCAG
CTGGAGTGCCTGGCTGTGTGCAGCAGCCAGACCTCACGTTCACTCACTCACATACCCCTT
ATCACTCTGCACCTGAATTGCCCTTGGCAGGCGTGGGATCCAGGCTTTTCGTGCAAGGTG
AGCAAAGCCTGCCAGGCCAAGTGGGCAGAACGAGCCCAGTGGGCCCAAGCAAAACTCAGG
CAAAGGTGCCACAGAGGTTTCCAGCCAGAAAAGTGACACCCCAAGGATCCTGTGACAATA
GTGTATTTTATGTGTGGCCCCAGACAATTATTCTTCCAGTGTAGCCCAGGGAGACCAAAA
GATTGGTCACCCTGACATAGAGCTTAAGTGTAAGTTTCATGAATTCTGACAAATGCATAT
ACCTGTGTAACCCACATTTCTATCAAAATATATAATGCTTATCGATGGGTGGGATAATCC
TTACCTGTTCCTCGTTTTGGAGGGCAGATAGAACATGATGATTGGAGATGCATGAAATGT
GATTAATGCCTCTGCCTAATCAGGACTTGCAACACCCTGAGTACTCCTCTCTGATTCTTC
AGGACAATCACTACTTTGAAAGAAAAAAATGAACATATATATAAATATTTCTATTACCCT
AGAAAGTTTCTCTGTGCTCTCTTCCAGTCCAATCCTCACCCTCCCACTGCTCTGCCAGAG
GCAACCACTGCTCTGATTTCTATCACCATAGATCAGTCTTGCTTGTTCTAGAATTTCATG
CAGGTGGAATTGTAAAGCATGGCCTTTTCTGTGTCTGGCTTCTTCCACTCAGCATGATGT
GTTTGAGATTTACCCATGTTGTCACAGTTGATGTGCTCTTCCTTTTTATTGCTTAGTGAT
ATTCCATTGTATGAACATAGCACAGTTTGTTTATTCATTCTCTGGTGGGCCAACGTTTGG
GTTGTCTCTAGTATTTAGCTATTATAAATAATGCTCCAATGAACACTTTCGTACAAGACT
TTTTGTGGACATATTTTTTTGGCTAAATATCTAAGAATGGTTTGCTGGATTATATGGCAA
GTGTACATTTAACTTTTTTTAGAAGCTGCCATACTGTTTCCTAAAGTGATTGTACCATTT
AACACTCGCCCCAGCAGTGTATGAGGTTCTAGTTTCTCCATATCTTGCCAACATATGGTG
CTATAAGTTTTTTAAATCTTAATCATTCTAGTGGTCTGTAGTGGCATCTCATTGCAATAA
TGATTTTCATTTCCTTGATGACTTAGGATGTCAAACTCTTTTTCATGTGGTACATTTGAC
ATAGAGACTTTAAGTTTTATGTAGTTGAATTCATTAACCTTTTCTGTTATGAATTTTATT
GACTTTATACTGAGAAATCCTTCTTTTTTTGGTAGAGATGGGGTCTTTCTATGTTGCCCA
GGCTGGTCTCAAGAGATCCTTCTACCTCGGCCTCCCAAAGTGCTGGGATTACGGGCAGAG
AAATCCTTCTTAATACCCAAAGCTAGTAAATATTTTTACTTTTATTTGCTTCTAGCCCTT
TATTGGTTAAACTCTTAAACATTACACTCTTTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved