Homo_sapiens Locus Mono:90:AL591004.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:90:AL591004.3
Homo_sapiens
Mono:90:AL591004.3
6
SNORD65L4
1001..1073
2073
GAGACCAATGCTGAACCTTCAATATCATATCCCTTGAATAGATCAACCAGGCACTTTGT
GGAAAAGAATTATATATGACTACTTTCAACTTGAGATCTGAATCATTTGTCCTGAATGAG
ATTAGTATGTGTTCTAGGTATGCATTTCCCTTTTCTGGAAAACATTTTCTCTATGAACAC
CACATATAGAATCACCACAGAATATCTGGATTAATAAAATTAAATCCTGCAAAACATCAC
CTCAGATGAAAAATCTAACATTGTGGTAAATAAGGTACAAGAATGCATCCTGAACCAAAG
GACCTACTTGTCCTATTATGTATCATTCGGAAGATACTATCATAATAAATCATTGGAATA
GATTTTTAAAGTTTCATTTAAAATTCTAATTTGGGAACAATATCTAGGAAAATTAGAGCA
CTGTTTTTCAAAATGTGGTACCTATGTTACACTAATAATCTTATTTGATGCTGAGAGATA
AGAGTGACTAGGATCAGGAACCAGTGAAAACAGAATTGGTCATTCTCACCAAAAGCCTAC
TTACAGACTTGGAAATATGTGCTTTCTTTGAAACGCAGTCTATGTAATTCTGAAAGTCCA
GGTAACTACAAGTAGAATGGTCACGTCTCCAGGGGACAAGAGCAGGGTCTCAAAGAACCT
AGATCTAAATCCAGGACTGATAACTAATCATTTTTGGCTCCTCATGCTATACTCAACAGG
AATATAAAGGAGTTACAATGATGGCAGAAGTAATTATCCCTAGTTATCATAAAGGGCCAG
AATTGCTATTACACAATGGAGCAGTGATAAGTATGTCTGAGATTCAAATGAGTCACTGGA
ACACCTCCTGGGGCTTACTTGCTTAGTACAACAACCATAGCCTGTCAAGGTCATGATATC
CAGGAATTTCAAACATTCTAGTTCATAATCAAAATTTAACACAGATTATATTCAATTACT
CCTTGTGTACACAGGCATTTATCAAAAATGTATTGGAGATCAAACGATGAACTCACCTAA
AATAGCTGTAATAACCAGCAGATTATGTAATGGCAAACCTACAGTTTTCTGAATATTAAA
ATAATAAAATTAAATATGTATGTATATGTGTATATATATATAGCAGAATTCCCATGCAAT
TATAAAATAATTCATATATTTATGCCTATGTGTTTATGTGTATAAACACACACATAACAC
AACTTGGGTTTTTTACATTGTATTATTTTAGTTACATATTACTTAGCCATGCAAAATCAC
GCAACTAGAACTAGTGAAGTCTGCAAACTCATCTTAGTTAATGAATATGAATACAACTTG
TGATTATACATTCCCTGTGAAGCAAAAATACATTGGAATCAGACTTTCAGTGTTCTGTCA
TATTATCATACCTGTATAAAGTGCCTATTTGTTTTATCAACCCAAATTTACAAATAATTA
TAAACTAATCTCTCAACATGCCCTTAAGGGGAGCATCGACTTATATTTATTGGAATTTTA
AAAAAGCATAGGCCACTTATCTAACGTTTCAAGCAATGTCTATAACAAATACATTGTGTT
ATTACATAATATATCAATAATTAGATATCTCATTTAACATAATGTAAAATTTGCTACAGA
GTGTTAAAAACCATGTTTTTCTTATTCAACTTGCTGTTTGAAGTAGAAGACAAACACGGG
CACATGCATTGTAAAGGTCCGTTATATTTTTACCATATTTTCAAGGAGAAATAGTGTTCC
ATCACGTTTTCAAAGAAAAAATAATAATTTAGGTGTGAATTTAAAGAAGAATCAAACTGT
AGTAACATACATTTATTTATTTATTATTAAAAATAATCTGGGATACTGAAACCTCATATA
TATTAAAACAAAATTTGGAACTTAAGACATGAGGATTTTTTAGACCACATCAGGGATAAT
AATTCAAAATATTCAGAGGTCAGAAGACTGTAAGAAGCATCATTTTTCTTATAATATTTT
TTCTCACACAAACTCCTGAAATAAAACATGATGATCTCCATTCTTACACATGAGAAAAAT
GAGACTGAGGAAGCGTGAGATAGGACACTTCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved