Homo_sapiens Locus Mono:284:AC009884.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:284:AC009884.8
Homo_sapiens
Mono:284:AC009884.8
8
SNORA62L3
1001..1154
2154
ACAGCGCAGGAATGAGGAGGAGCCAGTGGCAGGTATAGAATGTTCCCACACCTCAACCA
CTGCCAGGCTCCGCAGCTCACTGATGCAGCAGACACTGCTTCAGAGCACTGCTTTATTGG
TACCACTTCTGAGAAGCAGCAAAGCAGACATACGTCTTTCTCTATCATCTTCTCTGTCTC
TCAATCCCTCTCAATGACAATGACTCATTCTCTCTTTCAACCTCTCTCCCTTCCTCTCTC
CTACCCTCTACCCTCATTCCCACCCCCTTATCACTACACTAAGGCCAGCAAGAAGCCACA
ACCACAGAAGAGCTTCCAGGCAGCAGTGAAGCAGTTCAGTCTCAAAGAAAGCCAGACAGG
AGTCCAGATGCCTGTGTTCCTTCTGGAGTTCGCTATATGACCTCACTATAATCCCTTTAC
CACTGTGGGCTTATTTTCTCATCTGGAGGACGAATGGGTAAGAAGAGACTTCTGAGGTCT
TTTTCCTGCTTTAAAATTCTGTGATTTCACAATAACTGAATACAGTCACTAAACGGGAAA
CCACCAAGACACTGGGGGGCGGCCAGCACATAGCCATCTTTGTTGTATTTTTCATTGCAG
GCTTCCAAAATGTCTGTTGCCAAGAAGTATATCCAACTAGACCCTCGGCCCATGTTTTAA
TTTTTATACACTGTAATTAAAAGCAGAATGACTTGCTTTCACTTTGGATTATGTAATTTC
TTTCTATTCATAATGAGCAGCTCTTACATGATGCCAAGTGAGTTTTCTCTTAGGGAGCAC
ATTCTTACTCAACCAGAGAACTGTTGGCATTTGGATTAATAGAATCAATAGTATCTTTCA
TTCCAAAACCAGAAATTGCTGTTTTGATATGGTCTGCCCACAGTTCTTCCAAGGAAAATA
TTTTTATTATTTTACTACTAATATCTCCTTACAGCTTATACATGAGTGAAGCATTTATTT
TTATATTAAATAAATCATGCTCTTTAAAATAAAAATGAATATATTCTTCTTGTTAGAGCT
CGGAGTTGAGGCCAGTGACTGGCCAATGAACTCACAAGTGTAGACAGGGTGTTACGCAAG
GGACAAGTTTTTCACTAACACCACAAGAGTCTCTGGCCCAATGAGAGGAGTTTAATAGAA
ATTCTTGCTACAACTAAAAGAAAGAAAAGAACAAATAAAAGAATATACTCTCCTACTGTA
AAATCTACTTAAGAAAAAGTAGGTTATCAGGTCTTTATTGCAGAAAGTGGTTTTTATTTC
TTCTCTGCTGTGGAAACAAACCTCCAAATCATTGAAAGGTGGAACAGTATCCTTCTACAG
AAATCAGATTTAATCTTGACAGAATTAAATAAGAATCACTCATTATACACTGATCTATGT
TTTGGCAATTATACACTGATCTATGTTTTAGCAGATATTATGGAAAACTCAAAGGTGTAA
CAGGTTCTCTGCCCTGCAAAGAGTTTACAATCTCATATGGAAATCAAATGTACACACATG
ATAAATGCTACTTAAAGACCTACTGTCTGCCAAACACTATGGAAGGCACGAGGTATGTGA
GTGAGACTCCACCTCTGCCAAAAAGTTCCTCACAAGCTGGTGAGAAAGCCAGACCTGAGT
AACCCAGACAGTGCTAATCTCCCAGGATCACCTCCGCTGCACTTAGAGTGGGAAGTCCAG
TGGCTTTCCTAAGAATGTGGTGGCTTCCAGGGTAGACAGACAGGGAAGGAGATGGAGGTA
GCTTATCTTATGGTCACCTCTTGTCATTTCTCATCTCCTGGAGGTATTCCCTCTCTGTCA
AGTGAAAGTAGCACCTAGTTGGGTTGGTTGGTTGGTTCGTTGGTTGGTTGGTTGGTTGGG
TTTTATCAGTCTGACAATCTTTTATCTTTTAATTGGTACATTTAGAACATACACATTTAA
TATAATTACAAATACATTAGGGTTTACATCTACCATCTTATTTGTGCTATTCATCTCATC
TATTTTATCCTTCTCTCCTTTCTTGCCTCTTTTTGACTTAGTTTTGTTTTTATTTTTCCC
TCTCTCCCTCCACACACGCTCAAGTTTAGATGCTATATGCTGCTTTTGGGCTTTCATTAT
CCTAGAAATTACAATAAACATATCCAACTGATCAAAGTGTAAAGTTAATCAGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved