Homo_sapiens Locus Mono:173:AC079945.21
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:173:AC079945.21
Homo_sapiens
Mono:173:AC079945.21
3
SNORA24L2
1001..1135
2135
CTGTAGTCCCAGCTACTCCAGAGGCTGAGGCAGGAGGATCACTTGAGCCCAGGAGTTTG
AGTCCATCCTGGGCAACATAGCAAGACTCCATCTCTTAAAAAAACAACTTAAAAACAAAT
AAATAAAGTTCTCCTTTACATTACAAGAGAATGACTGACATTACATGTCAGTTGCCAGGT
GAGATAAATCTCATGTGGTAGCTTGAGGCACTTTTCTATTAGGTGCTATAAAGGAAGTAA
AGGTTTGTCCATTCATTTATTCAAAAGCAATCAATTTTTAGCTTCCAGAGTATGACCACA
GGGACACAGAGATGAACCAGTGCACCAGGAGCTCCCAGTTCTATGTATGTGGCTGGGGGA
ACACCCACAGGAAGACAACCGCACATCACACTAGCACGTAATCTCCCATCCTTCCTCTTC
CTTGTGCCACACTAGCCACAGCTGCTTTTTAGAGCCTTCCTGCACACAGGCTGCATTGCA
CCCCTCTGCCCACAGTGACTCTTTTGGAAGAGGGCACTTGACCACATCCAGGGCACTCAG
GGCCAATAACACTCAATGGATCTGTTTTAGGATGGAAGGAGCATGAAGAAAGATTAAAGC
ATGTCTAGAATTGTTGGGGACTTCCTGTCACCTTGAGAGAACCTGAGAACCTGAGAACCT
GAGAGTGAAGCTGTCTTTGGCCGTGCCTGCTGCTATAACAAAATACCTTAGACAGGGTCA
TTTATAAACAATAGAAATTTATTACTCAGAGTTCTGGTGCCTGAGAAGTCCAAGATCAAA
GCACTGGAAGATTCAGTGTCTGGTGAGGGCTTGCTCTTTGCTTCCAAAATGGTGCATTCT
GTCTGAGTCTTCCCATGGCAGAGGGAGTGGGAGGGATGATCAGGTTCCCTCAAGCCCTTT
TGTAAGGCCACTGGTCTCTTTCATGAGGGTAGAGCCCTAATCACCTCCCAAAGGGCACAC
CCCTTAATACCATCATTTTGATGGTTAAGTTCCAACATAGTCTCCATGTGTCTTTGGAAC
CTGTCAGCTGTGGCAGTTGCCCTTCCTAGCCATGGAAGAGTAAGTATATTCTTGTTTATT
GGCAAAGCTGTCACCATTTCATTGGTATCAGATTCTGACTTGCACAAGTAACATTCTTCA
CCATTAAAAACCTAGAGGCTGCTGGGTTATTGGGCAAACTTTTCCAAACTATTGTTCAAA
TGTTTCTAGAAAAAAAAAAAAAAGTTTCCAACATAGGAATTTTGGGAAGGGGCACCAACA
TTCAGTCGATAGCAGAAGCCAAGTCAAAATAAGAGGAAAACAGGCTGGGTGCAGTGGCTC
ATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCACCTGAGGTCAGGAGT
TCGAGACCAGCCTGACCAACATGGAGAAACCCCGTCTCTACTAAAAATACAAAATTAGCC
AGGCATCGGGGTGCATGCCTCTAATCCCAGCTATTCAGGAGGCTGAGGCAGGAGAATCGT
TTGAACCTGGGAGGCAGAAGTTGCAGTGAGCCGAGATCATGCCATTGCACTCCAACCTGG
GTGACAAGAGCGAAACTCCATCTCAAAAAAAAAAGTGGGGGGGGAGGGGGCGATGAGACC
CTATCTCAAAATAGAGGAAAACGAGGAAATGAAGAGGGACTTGTCTAAGTGATGCAATTT
TGGGCACCTGTATTTAGCCATGCCAGAAGCCATCTGCTCCCCTCCCTGTCCCTCTTGGTC
CCCAACCCCACTTTTAGGCCTTTACCACTTGCTTAATGGAAAGTCACAGCCGCACCCAGG
GGCTGCCTCAGAGTGGACTCAGAGGCTTTGGCTTCCCCAGTGACTGCCCAGATGAGCCAG
GTAATATAACCCAGAAATGTGGGGAGTGAACTTTCCTATGAGTAAACTCTGACCAGCAAG
ACAGGATTCAGAAAGGAACTGAGGGGTAAAATCTCTACTTTACCTCTTCTCAGTAGACTG
TTGAGCATGACCTCCCTGGAGATGTCGCATGGGACTAGGTTATCAGAATTTGCAAATACA
AATACTTATGTTAAAACATTATTTGCGTTCATCTGAAATTCAAATTTAATCAGGCATCCT
TTTTTTGATCTGGCAGCCCAAACCCAACGACCATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved