Homo_sapiens Locus Mono:297:AC104212.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:297:AC104212.3
Homo_sapiens
Mono:297:AC104212.3
8
SNORA20L3
1001..1131
2131
ATCCTAAAGGCAACAAGAAACCTTTAAAGAGTGTAAGAAGAGGTCGGGGGTGGTGGCTC
ATGCCTGTAATCCCAGCACTTCTGGAGGCCGAGGCAAGTGGATCACCTGAGGTCAGGAGT
TCTAGAACAGCCTGGCCAACTGGTGAAACCCCGTCTCTACCAAAAATACAAAAATTAGCT
GGGTATGGTGGTGAGCACCTGTAATCCCAGCTACTTGGGAGGCTGAGGCATGAGAATCAC
TTGAACCCAGGAGGTGGAGGTTGCAGTGAGCCGAGATCACACCACTGCACTCCAGCCTGG
GCCACAAGAGCAAAACTCTGTCTCAAAAAAAAAAAAAAAAAAAAAGAGTATAAGGAGAGA
ATCAACATAATCAAATGTGCTTTAATGGGAGGGTAAGAAGTTTTCACAGCAGTCTGCTTG
AGAGATGATGGTTGTGGTGACGATGATACAGAGAGGCAAATGGGTTGAAGATGTATTTAG
GAGATAGAATGGGAAAGACTTGGTGATTAATTAATGGGGAGGGGGCACAGTAAGGAATCG
GAAGCCATCAAGTAGTCAAGGAAAAGTCAACAATGACTCCTAGATTTCTGGCTTGAGCAA
CTGAGGGGATGGTGGTGCCCTTTACTAAAATGGAGGACAGGCTGGAAGCAGTGGCTCACG
CCTGTAATCACAGCACTTTGGAAGGCCAAGGCGGGCAGATCACATGAGGTCAGGAGTTTG
AGGCCAACCTGGCCAACATGGTGAAACCCCGGCTCTACTAAAAATACAAAAATTAGCCTG
GCGTGGTGGCGGGCACTTGTAATCCCAGCTACTCGGGAGACTGAGGCAGGAGAATCACTT
GAGCCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATTGCACCACTGCACTACAGCCTGGGC
AACAGAGTAAGACTCCGTCTCAAAAAATAAATAAATAAAATAAAATAAAATGTAGGACAC
TGAAGAAAGTAAGAATTTCCATTTTAGAAAATATTGAGCTTCTTCCCATTTATTTGCTGC
TATAGTCTCATAATGATACAAGCAGTTATATGCATGGGATAAAATAATATTGGGACATTG
TAAATTGAAATGAAGTAACCATTTTCATCTTTTCTGCATGGACAAGACATTGTTTTTGGT
TTAAAAAAAAAGAAGAAGAAAGAAAAAAAAGAAACAAAAAGAAAATCCTGAGCTTTGCAT
GTCTATTATGACACATGCTGTGAACATGTCCAGTTGACCACTGGATAGACAGTGATGAAG
GTCTAAGAAAAGTCTTTGCTGGAGTAATCAATTTAAGAATCACCAGCATGAAGATGGTAA
TGGGAGTCTCAAGAGTAAATGGGATCACCTAAGAAGCATTTGCAGAGTGACAAGAACAGA
GGAACTCAGGATGGAGCCCTTAGGAACCCCAGCATGTAATAAACAGTACAGGAGGAAGAA
CCATTGGAGGAGACTGAGGAGATAAACCACAGTAGACAGATCACCAGAAGGACACACCAC
AAAACCAGGGACAGAAGAGAGGTCATGAAGGGGTGATCGGCTGTGTCAAACATTACTAAG
ACATCGAGATTTAAATCCAGATTGAAGTGTACATTAGATTTAGTAGCATGGAAGTCTTTT
TTAATCTTAGTATGAATAAAGTACCCAAATAACTAAGGCAAAGTTCTCTCAGGTAACCTC
TTGATCCCAGTCCACTTGTTTTGGGAACCAGGCTATGCTTGTTTCCTAGAGTGGAATTAA
AAGTCAGCATGGGTGGCACCTGGGGAGGCCGAGGTAGGCAGATCACCTAAGGGCGGGAGT
TCAAGACCAGCCTGACCAACATAGAGAAACCCCGTCTCTACTAAAAATACAAATTGGGTG
GGGGCGTGGTGGTGCAAGCCTGTAATCCCAGCTACTCGGGAGCCTGAGGCAGGAGAATTG
CTTGAACCTGGGGGGCGGAGGTTGCGGTGAGCCAAGATCGTGCCATTGCACTCCAGCCTG
GGCAACAAAAGCGAGCTCTGTCTAAAAAAAAAGTCAGTATGGGTGCTATGACTACAAGAA
ATCTACCCACATGAAAAAGGCATGTGAGGGGAAATGGAGCATGTGAACGATTTATACAGA
GGTATTAACAGGAAGATTTTATATATTATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved