Homo_sapiens Locus Mono:210:AC004998.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:210:AC004998.2
Homo_sapiens
Mono:210:AC004998.2
X
SNORD30
1001..1070
2070
ACTCCAGCGTGGGTGACAGAGTGGGACTCCGTCTTAAAAAAAAAAAAAAAGAAAGAAAG
AAAGAAATTTATTGAGAGAACTACCTGTGATAGAAAATGGGGAAGGAGCTGAAAGAATCT
GGGAGAACTGCCAAACTACAATGCAGAACTGGCTCTGGATGAAAGGGAAGGGTAAAGAAG
GAAGAATTAAATAAAGGTTGGGAGAGAAAGCATTCTAGACTTCATTGTGGTTTAAGAGAC
TTCTGAAAGGTCGTTGGAGAGTCCTTGAGCCAAAATCCCCTATCAGAGCAGCCCTGCATG
TCTTAGAAATGGACCTGTCTTAGAATCTCTGCTGTGCTCAATTGTTTATTGGCTAGAAGC
AACCCTTAGGAAGAGTGGTCTGTGCACAGCACAAGTACTGTGATGGATTTCTAAGTGCTA
CAATTGGGCCGCAGGTCAGTTACACTCTCTTCCATCAGAGATATAAGAAGCACATTTTCA
TGGCACTATGCATGGTGTATTAGTCCATTCTCACACTGCTATGAAAAAATATCCGAAACT
GGGTAATTTATAAAGAAAAGAGGTTTAATTGACTCACAGTTCCACATTGCTGGGGAGGTC
TCAGGAAACTTACAATTATGGTGGAAGGCAAAGGAGAAGCAGGCACCTTCTTCACAGGGC
AGCAGGACGAAGTGAGTGCAAGCAGGGGAAATGCTGTATGCTTATAAAACCATCAGATCT
CATGAGACTCTCTCATTATCATGAGAACAGCATGTGGGAAATGGTCCCCATGATCCCATT
ACCTCCACCTGCCCCCACCCTTGACATGTACGGGTTATGGGGATTACAACTGAAGATGAG
ATTTTGGGTGGGGACACAGGCAAACCATATCAAATGGCAACATATATTTATATATTTGTA
GGTCATTTTAGCAATAGTTTTTACATTTGGAATGTTCATTTCCTTTCACATGGCAGTTCT
ACCTCTAAGAATTTATCCTTCAGAAATATACAACTATATATATACATGATGACTTACATG
GACTCTCATTCAGCTAATGACTTGCTGCTGAAACATGGAAATCTGATTTTTAAAAATATA
AAATAAGTAAAAATATAAATAAATTAAAATAAAATAAATTTTTAAAATAATTACACGACT
GTAAAAATCTATGAAAAGTAATGATTATTGCATCATCATCATGGGTCATTGTTGAAAATT
AGAAACAATTTAAAAGTTAATCAATAGCGGACTGGGAAAAAAATAACATAGCATTGAATA
TGATATTGTCAGGATATATGTACATTGAAAGGAATACATGAGATAGTATTGAGCAATAAC
GGATTACAAATAGGATGTCTCCTGTGAACTTTCATGTCTATGAAAAAGAAAGTAAACCAA
GTAAGTGGAATAAAAGTGCTCATCTTTCTGAATATAAGCTGAAATTCTAGCTCAATATTT
TGTCTCATAAAGAAAATGAAACATAAAATTTTTCCCATAGTAGAGAACCCTTCTTAATTA
CTTTCTTTTATTATTATTATTATTATACTTTAAGTTCTGGGGTACATGTGCAGAACGTCC
AGGTTTGTTACATACGTATACACGTGCCATGGTGGTTTGCTTCACCCATCAACCCACCAT
CTACATTAGGTGTTTCTCCTAATGCTATTTCTCCCCTAGCCCCCCACCCCCCGACAGGCC
CCAGTGTGTGATGTTCCCCTCCCTGTATCCATGTGTTCTCATTGTTCAACTCCAACTTAT
GAGTGAGAACATGCGGTGTTTGGTTTTCTGGTCTTGTGTTAGTTAGCTGAGAATGATGGT
TTCCAGCTTCATCCATGTCCCTGCAAAGGACATGAACTCATCCTTTTTTATGGCTGCATA
GTATTCCACGGTGTATATGTGCCACATTTTCTTTAATTACTTTATTTTGAACAACTACTT
GGAAAAAATACATAAATCTAAAATGGCCTTAATCAATGTTAGTTTTGTATGTTAATAGAA
ATTATCAGCCAGAATTTATAAGAAAAAAAGGAAGACAAAAAATCAACACTGATTTTTATT
TATTTATTTATTTATTTTGAGATGGAGTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved