Homo_sapiens Locus Mono:242:AC007688.15
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:242:AC007688.15
Homo_sapiens
Mono:242:AC007688.15
12
SNORD88CL1
1001..1087
2087
TAATTCCAGCACTTTGGGAGGCTGAGGCGGGTGGATCACTTGAGGCCAGGAGTTCGAGA
CCAGCCTGGCCAACATGGTGAAACCCCCGTCTCTACTAAAAATACAAAAATTAGCTGGCC
ATGGTGGCACATACCTGTAATCCCAGCTACTTAGGAGGCAGAGGCAGGAGAATCACTTGA
ACCCAGGAGACAGAGGCTGCAGTGAGCTGAGATCACGCCACTGCACTCCAGCCTGGGTAA
CACAGTGAGATTCTCTCAAGAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGTGA
GAATATAGAATTGAAGACTATGATCCTCTGCAATCTGGCCTCAACCCATCTCTCCAGCTG
TTTCCCATCTTCCCAAACTCTTGACCTCAGGTATACGCATCTTTACATAGTCTCCTTGCA
AAAGACACTGTTGATCAGCTACCTCAGAGCCATTCTAAATATTCTTCTTCCTTGCTGCTC
CTCACTATAGAGGCTACAAAACCCAACACACACTCTCTCTTGCAGCTATGGATGGCCCTG
TATGTTAGTTTTGGCCCATGAGATAAAAGTAGAACTCTGATGGGGAAACTTTTGGGAAAG
CTTCTGTTTCTTCATAAAATGGGACAGATGCAACTGATACAGCCTGTCCTCATCTCCCTA
ATTTCCTGCCTTAAACATGGATGAGATGGCAGGAGCTGCATCAGCCATCTTGCAGCCCTG
AGGGAGAGAGAAAGGCAAGTGCAGAGACATCAGCATTGAGTACTGAACCTGTCTCTGGAT
TTCTTGCTATGTGGGAAAAGAAAACCTTCTTGGCTTAAGCTACTGTTGGTTTTCTGTTAC
AGTTTCATGCATTCTTAAATGATAGATCCCTGAGCTAGGTGCTGGGCATACAATGGAGAA
CAAAGCAGGTATGGGGCTCCTCCTTATCAAACTTACAGTCTTGTGTGAGAGACAAAAAAA
AAAAAAAAAAAAAAAAAGAGGAAATGAATAAGTTAAAAAATTACATTCCATGATGTCCAG
CACTGGGCTCTGATCACTCCGGAGGACACAGTTTTCCCCAAGACCATGGCTACCTGGGGA
TCTGAGAGAAAAAGGAAAATAATTATACAGTGGTTTGTATTATGAAAAAAGCAAAAATAT
AATGGTATGATGGAGAACTATAGGGGAGGCTGACTCTATTTTAGCTAGAGGGGCCATTGA
AGGCCTCTTTGAAGAGGAGGTAGTTAGGATCTGTAGGATGAGAAAACCTGGCCATTTGAA
AAGGAAGTGAAAAGGGTTTTAGGCAGACAAAACAGCTAGTGCAAGGGCTCTAGGGCAAAA
AAGGGCTGTGTGTGTTCAAAGTCCACTGTGGCAGAAGGGTATTAAGGGAGAGATTGGAAA
GAAAGAAGTAGTCAGAAGGGGCCAAATCACACAACGCCTTGCAGGTCATAAAATGGAGTT
TGAATTTTAGTCTAAGTGCAAAATAAGAATTTTAAAGCAAAGATCCATTTGGAAGTTGTG
TAGAAAATGTGTCCAAGGGGGCAGGAGCAGAAATGTGGAGACCAATTAGAAGGCTGTTGC
AGGACTTCAGGCAAGAATGATGGTGATACATCCTAAGATGGTACCAGCAGAGATGGCTTC
AAGATGATTTAGGACTTGGGTCAGTAGCACTTACTGATGTAGTGGTTTGATACACACTGA
TTACCTTCTTCCTTTTTTATTCTCTGGCATTTCTCCTATATAACTAGCCACTTTTAAACA
ATATTTGTCGGCTCTTTTCTTCTGCTTGTCTGTAAATATTAGGGTTCCTGAGTCCTTACC
TAGATTTTCTTCTCTTCTTACTCCTGGCCTTTCCTTGGGAGAGTTCATAATTCACCTACT
CCATCTAGATATTTGTGATGTCCAAACACATCTCCACGTTAGGCTTCTATTTGTAGCATC
AGACCCACACTTTCAACTGTCCACTAGATAGCCTCACTTGGATGCTCTGCAGGCCTAAAT
AACCTTTGCGGACAGATTAACAGGGAAAAAATATTAATAGGAAAAAATATAGATTTTTAT
CTGATGTTAATATTTCTATGTGGCATGGAGGACTTCACAGAAAAAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved