Homo_sapiens Locus Mono:64:AC018515.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:64:AC018515.7
Homo_sapiens
Mono:64:AC018515.7
15
SNORD77L3
1001..1065
2065
TTAAGGCTTAAAGTACATCTATTACTTAAGAACTCTTACCCAATTTGCATATCAAACAC
AAAACTTTTAATAAAGTTTTGGACATGCTTGAATATCTATCTGTTTTACAACTTTTCGGG
TTGGTTTCAAAAAAGAAAACTATAAAGAAAAAAATAGGTTTAGAGCTCCTCTGGCTTAGA
GCTGTTCTCCCAGTCTTCCAGAATGTCTCTTTCACTGAGTTTCCAGGACAATACAGCAGA
CACAGAAAGCAAGGGAAGAAGCCACGATAACTTACTTTTTTAAAGTTTCCTTATAAAAGC
AGCCCAAGATCAGTATTTGTGTCTGTTTCATAATATAGCAATAAATAAGGAACAGAGAAC
ATAAATAATGAAGATATTATAGTATGCCATTTTCTTCTATTTACACAGCACTTTAAAGTA
TATAAGACAGTAGTAGCCTTTTTAATGCTTATTGCCTCAGTTATTTTAATGCACTGAGTC
TGTAATTGTACACTTATTAGCACAGAGCTAGTGTACTCGCAGTCATTAACCAGCCCGTTC
CTCAGCATTCAAAGCTATTCATCCTATTACAGTTAATTGGAAAGCAAATTTAGAATTTTA
TTAGAGTTTTCAAAATCCAGTTTAACAGTAATTAAATATTTTTTGTCAATTTATTTAATT
TCTGCCTCCCCCATGAGATTATAAACTCCACAAGATGAAACTGGTGACAGTATTGTCTTT
CTATCTGTATCCCAGCAGGTAGCCCAGGAAGTACATACCTCAGCAGCAATGGATGGATAA
AAATCACTGGGATAGTTATATTCACTGTCATTGTCACTGTCCCAAGAGCCTCCCTTATCA
AGACTCTCTTCACTATAATTTCAGCACAAATATCTAGAACACCTAAAGCATGCACAAGTA
CAGCTCCCTTTTGCATTGAAAAAGTAAAGAAATATTTTAACAGCCTTGGAGGGAAAGGTA
TACACACAGGAAGCTCATCTACCTTCATTGAGATAACTTTTATACTATGATGTTTGCATA
GTTCAGCAGATTGAATTATGAAGAGATCTACCATTTGTCTGGTGTTAAAAAAAAAAAAGA
TAACTTTTAACTATTTTTTACTAGGTTCAACTTTTCTCTAATATTCATTCTCAAGAGCAA
ACCCCTAAAGGGCTATAGTCAGGAGAACTGAAAGGCGAAGTTTTTCGAAGGCTCATCTTC
TCATATGTGGACACGGTCTGAGCCAACTCTGAGGGAAGGGGCTAGCTCTGGACACCGTCT
ATTTCTCGTGCAGTGCAGAGCGCTGAGTGCCGAGTTTGGACTCACACCACCTGGTTCACG
TCTTGGCTTAGGCACTTGCGAGTTCTATGACCTCAGACAGGGAACGCTGTGTCCCTAAGC
CTGAGTATCTTCAAGTGTAAAGTATAAATAATAGCCATCTCTAGGACTTTTATAAAAGTA
AAATGAGATACTTCATATAAAATAGTAGGCATTATGCCTGGAACACAGAAACGTTTGGAT
AAATCTTACTGTTAGTTTCTGTTGCTAATGCTAATGCTAATAGCAGAGCAAGAGACTAAC
AAATTCCTAATTATTTTTTAAAATTTTCAGACAATGCTACCTTTGTAGAGGGACAGGCAT
AAACCTAGGAAAAGCTCAAAATCAGGATAAGCAAAGTACTGCAAATACCAAAGTTTACCT
AGCCTTTTGTGAGTTCTACTACCGATTACCTAAGTAATTTCGAGCTTCACTCAACTGTGA
GATCGAGATAATCTTTGTTTCAACATCGTATCATTTCCATCTTCATTTCTCTCTCTCTTT
CCTGTCCACTTCCACCCACATCTTAGCCCTGATTACCACCCTGAATTACCCACATTTTAA
TTTCATTCTAATGACTAGTTCGGTTCTGTCACAACAAACTAACTCTCAGCTGTTATTCTC
AACTAAACCTTCTTTCAAGATTAAGAATCAAATATTCAAGAAGCAGTAATTTTACTCAAT
CCTCAACTTCTTAATGATATGAAAGAGTTTCAAAGACATACTGCATGGTGAAACTTTCCC
TAATAAGGGAAATATTTTTGGTGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved