Homo_sapiens Locus Mono:221:AL592436.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:221:AL592436.7
Homo_sapiens
Mono:221:AL592436.7
1
SNORA42L1
1001..1134
2134
TACAGTCTTCAAACATGTACTTTGTTTTAAATGTTTTTTTAAAAAAACATGAGGGCCAC
AATAGACTAACAGGGCCAGATTTATTCTCCCACCTGAAATAACTATGAATTAGGACAAAA
TATAGGAAACAACAGGATTCCAGAAATTGGACATCAGGTAACAGAAGACCACGATTCCTG
AGAGACTGAAAACAAATTAGGTATTCCCTACAGTTGTCACAGCTTGCTGTCTAGAGGGAA
TTTTTAGGTTGTACAGGGAGAGGAAACCCAAGTGGAGACTATTGATCTCCTTGCCTTGAA
GAGGGAGGCCTAGGATCTCAGGGAGGCCAAGGAGACTAGAGTTTGCAGGACAGAGTAACA
GAGATGAGAGGGCTGCAGAGAGAGAAAACCCTGGAAATCCACAGCAAATCCCCTCAAGCA
TTCAGCTGAGTCCTGTTGAGTGCAGATGTGTGAGGAGAGAATCCTCTGAATGGATAAGAG
GGAACAGTACCTAGAACTCACACAGGAATGTAAATAGTGCCTGTTATGACCAGCCAGGCT
GAAAAACCTCAGTTTGTGGAGCACTGGGTAGTGTAATCAGAAAGGTATTCCCTCAGTAGT
GGGACAAAAAGCCCCCTAGTTGAAACATTGCTCAGGTTGTGCCAAACAAAGCTTAGAAGC
AAGACCTGAAAGTGTCAAACTCTTTCTAATAACTCTGTATTACAGAACAAAGTTCAAGGA
TATTTATGAAATGCACAAATATCTGTCACCCAATAAAGCAAATTTACAATGACTGAGATC
CTATAAAAATTACCAAACATATAAAGAAGTATACAGGAGAAAGTGAGCCATAACAGGGAG
GACAATATATCAACTGAAACTCACAAAACTGACATAGATGATAGAAGCAGAAAAACAAAA
TCAAAATGGTCATCTTAAGTTGTATCTCATATATTCAGAAACTTAGGTGAAAGATTAAAC
ATGATAAGTAGAGAAACGAAAGACATAAAACAAACCCAACAGCATGGTAGTGGGTTCATT
GGGGGCCCTTCTCTGTGGGCCTCATAGCGTACCCATGCCAGTGTAAACTTGAGCCTTGAA
CCATTGCCCAGCCTCCTTCCCATGGGCTGTGTGTAGCGAAGGGGGTTGCACAGTGTCAAA
CAAGCAAAAAAATCCAAGTTGAGCTTCTAGAGATGAAAATTATAATTTCTGAAATAAAAA
TTACACTAGATAGGATTAACAAAAGGTAAGACATTGCAGAAAAAAAATTAATAAACTTGA
GGACATAGCAATAGATACTATCCAAAATGAAACACAGAGAAGGCCAGGCACGATGGTTCA
CACCTGTAATCCCGCACTTTGGGAGGCTGAGGTGGGCAGATCACGAGGTCAGGAGTTCGA
CACCAGCCTGGCCAACATGGTTAAACCCCATTAAAAAATACAAAAATTAGCTGTCTGTGG
TGGCAGGTGCCTGTAGTCCCAGCTCCTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACAT
GGGAGGCAGAGGTTGCAGTGAGCCGAGATTGCGCCACTGCCCTCCAGCCTGGGCAACAGA
GTGAGACTATGTCTCAAAAAAAAAAAAAAAGAGACATAGAAAAAAATTGAAAAGTGAGTC
ATGGGTATAATATACATGTACTAGGGGTTTCCCAGGAGGGGGATAGAAAAAATACATGAA
GAAATAATGGCTCCCAACTTTCCAAATATCATGAAAATGATAAACTCTCAGATTCAAGAA
ACTCAATGAAACTTGAAGAAAATTGCTCAACAACATCAAATTGCTCAAAGCCAGTAACAA
AGGGAAAAACATTTGGGGGGATGAGGGGCACAGGGAATGGAGACATTACATACAGAAGAA
CTAAGAGAAGAATAACAGCAAATTCATCATCAGAAACAATGCCAGCATGAAGACAATGGA
GTAACTTCTTTAAAGTACTGAAAAAAAAAATGTCAGTTTAGCATTCTACACAATATACTT
TTATATCCACTGAAAATATCTTTCAAAAATGAAGGCAAAGTAGATAAATTTTTAGACTTA
AAAAATCTGAATGTATTAATCACCAGCAAGTTTATGCATCTTCTGCAATGTCTAATCAGT
TGTTAATCCCATTCAATGTTTTTTTTTTAAATTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved