Homo_sapiens Locus Mono:194:AC002069.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:194:AC002069.2
Homo_sapiens
Mono:194:AC002069.2
7
SNORA67L2
1001..1140
2140
AATTATGTAAAATTTCATTGTAAGATAAATAAATGGCTTAAGTAATCAGTAAAAGCACC
TTTTGTTTCTATTGGCCCTTGGTAACCATTGCAGTATTTCTAGTGGAGACCAAATTCATG
TTTGTTTGCATGCTCATCTGTTCAAGATATAAACTATTGAGTTCTTGCAAGGTAACAGAC
ACTGTATAAAACCATTAACAAAGAAAGAGATGTGCCTCGTATTCCTTCTATTTCTTCCTA
GAGCTCTTAGGAGTAGAAAATAACTTGTATGCTGGTACATTAATGTGTCTTCTACTTGCC
TGTACCCATGAAACAGAACCATGAATTCTCTCATAATCATAATAGTGGCAGAGTTAACTC
TTTCAGAAAGGGTCTGTTTGAAAAGTAATTAGCATTTGAATTGAGAAATGATTGATGACT
TAAAGACAATAAAGTGTTTATTTATTTATTTTTTATTTTTTTGGTTTTAAGGAACAGAGA
GTTTAATAGGCAAGAAGGAAGGGAGAAGAGAGAAGGAAGAAGTTTCCCTGTACAGAGAGA
GGGAGAGGGGCTCCAAAGCCGAAAGAGGAAGTCCTCACCTGATGCAGATACCAGCTAGGT
ATATATGCAGAGGCTGGATGAGGCAATGTCTGGTTTGCATAGGGCTCAGGGGATTGGTTT
GACCAGGCATGTCATTGACATAGCTGCAAAAAAGCTGGCTCTCCCACTGTAGCCTTTTAA
TATGCAAATGCAGGGTGCCCTGGATGTTCTACACATGTGGAGATATGTGGGGAGATATGT
TGAGAGCCAGGTAGGCAAACTTTGATATGCAAATGCAGGCCATTAGAAACTGGGTCCACC
CAACATGGTGATTCCCATGGCCTTCATGCCCTTGCCTGACAATAAAGTGTTTAATTCAGG
GACTCCAAAAAGACAAGATTGACTTTTAAAATCATTTGATAAATGCCCAGAGGATTCACC
TAACTGATTTCATTCTTTCTTGCTTTAAAACACATATTCCTATCCAAGGCGATTCCCTCT
CCAAGGGGACATCTAGTGCCCCTCTCAGGAAAGTAGCAACTTGGAATAGAATCTGGCATG
CCTAAGGTCTTTGAGGAACAGGGATGCTTATTTCCTCTGCCTTCCTTGGCTGCCTACATA
GATACCTAAGTGTCTTCCCTTCGGGATAGATTGTCCTCTGGTGCACATGCTGAAGAGTTG
TCTTTCTTGACATAGGCCAGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCATCAACTAT
GACCTTCCGACCAACAGAGAAAACTATACCCGTAGAACTGTTTGAAGTGGACGGTTTGGC
CGTAAGGGTGTGGCTATTAACGTGGTGACAGAAGAAGACAAGAGGACTCTTCAAGACATA
GAGATTTTCTACAATACCTCCATACCTTCACTGAGGAAATCCCCCTCAATGTTGCTGACC
TCATCTGAGGGGCTGTCCTGCTACCTAGCCCCAGCCAGGGTTCAATCTTGGGGGTCAGAG
GAGCTGCAGGAGGCGGGAGGGAAGGGAGCCAAGGGATGGACATCTTGTCATTTTTTTTCT
TTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGAACATTTTAGATACCCTTT
CTTTAGGGTAGGCTCTTGCCCCAGGCACTGGCTCTTCTCCCAAAAAAATACTAATCCATT
TCCCTAACCTAGTAACCTCCAGATCCCAGAGGCTTTCTTCACCTCAGCTGAGCTCCTTTG
AAAGTGATTCAAGGGACTATGTCACTCAGCCTCACTTGCTGGACCAAATCTAGAGGGAGA
ACCCCTAAAACCCCGGAGTGAGTTTGCCCAGGGGATTGAGTCCCCAGGTCCGGGGAAGCT
GGGGAGAGAAAATAGTAGCCATTTTTTACATTGTTTTGTATAGTATCTATTGATTCAGGA
AACAAACACAAAATTCTAAATAAAAAGACTTGGAAGCTGCAAAAAAAAAAAAAAAAAAGA
AAAAAAGAAAGAAAAAGAAAACCACCTATTACTTCCTTTATTCCCTAGCATCCTCAGAAC
TGTCTACTGCCTTCAAGGACACACACACACACACACACACACACACACACAAATAAGGAC
TATCATCAACCACTCTAATCCTGTTCCCAAAAAAACACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved