Homo_sapiens Locus Mono:278:AC005994.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:278:AC005994.2
Homo_sapiens
Mono:278:AC005994.2
14
SNORD56L5
1001..1071
2071
CTACCCCAGTTCAGATCCCAGTCATGTCTCACCTAAAAAATTGCAGCAATCTTATTAAC
TAGTATTTCTTTATATATATATAATAGTATCTTATTACTAGTATTTCTTTATTCAGTATT
TTTCCTCTTTCAGGCTGTCTTTCACAATACTATTGAAATTTTTTGGGGGGTGGGTGGGGA
ATAATGTGTGTGTGTGTGCACACATACAGGCACATATGGTTTTGATTGTGACAATTTCTA
ATAAACCTTTTGGTAGCTGCTCACTGCCTGCAGGCTAAGTTAAGCTCCTGAGCAGGTCAT
TTAAAAACTTCATGGAATCCTTCCAGCCTTCCAGTGCCAATGCCTCAGTCTCTCTCCTTG
CCCTTCTAGTTGCTTCCATCAAATGAACTATTTTCTCTGCAGTTTGGTTGTTAGTGGAGT
AGTGCTTTGTTAGTATTATTTGCCAAGTATTCAGACTTTCTTTTGTTCAGGCAGCCTTTT
AATCATAAAAGCCACTATTTCATCTTGTTTGTACATCTTATGTAAGTACACAGGCATTTT
TAGCATCTTAGGTGGCAGAGTTTGTGTTCTACTTTTAATTGACCTTTATAAGATGTGACA
AATTCCCACACAGAGTTTCTTTTTTTCTTGAAAGGTTGATGGCCTAACTGGAATTAAATA
ACCAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTTTTG
CTCAGGCCGGACTGCAGTGGCGCTATCTCTGCTCACTGCAACCTCCGCCTCCTGGGTTCA
CGCCATTCTCCTGCCTCAGCCTCCCGAATGGCTGGGACTACAGGCGCCTGCCACTGCACC
CGGCTAATTTTTTGTATTTTTAGTAGAGACGGGGTTTCACCGTGTTAGCATAAATAACCA
AAATTTAATTGCATTTCTTTAGATTAATTTTCAAAGGTTATTATGTTCCAGGTATTACTT
GAAAGTTCTGAACTATTTTTGTGCATAAAATTATGTTTTCACTACAATCATGGCAATATT
TTTTGTCAACAGCGGTTCACCTAGTGAATGTTGATACTTTGGGTTTGAGTGAAAATGAAT
TGTAGCATTTTCTTTTGCATTAATAAATACCGTACTCACTTAAACTACCTGATAGAACTA
CAAGTCCTCCAAGTTTCATTCAGATTAATGTATTCCCTGTATTTAAAAGTAGATAGTTAC
ACATGAGCAGTGACTCCGAGTGACACGCCTTGTGTGGCTGACACTCTTGGGATGCTGAGA
TTTGATGATCATCTTTGTAATCTCGGAATGACTGATAGCACACAAGTTCATGGATGCCAG
AAATGATGTAGAAGTAGGCACCTGAGTTCCCTGGCTTTCTGAAGGGTGAGGCCAAAGCTA
GATGACAGACACCAGATAGATAGTAAGGACAAAGTAGAACTTTGTGGTCTTTTGCTGTCC
TTGAAGTGGTACCTATTTACACTTTGTGTCCTTGCTGCTTTTACATATCTTTCTCTGTGA
ATTAGGTTGTGAACTTTTCAAAAGGAAGTTCAAGATCATCATGATCTTTGGAGCTCCACA
GCTTTTTGCTCAGAACCTTATACCCAATAGATGTTTCATAAGTGTTTGAATTAAAGTAAA
TACATATTCTTAAATAAAGTAATAATTGCACTTTAATTAAAATCTAACCTGTTTGGCTGG
TGAGGGTGGAGATAGATCTCAGCTTTCATTGAGGAGTGGCAACTAAGTTTAGCACTTATT
TTTGAGAATAAGGAAACACACAGCTGAAATGATGTCATTTAGGACTGACCACTATGATGC
TCATAACATGTTCCTTGATGCATATTCAAGTCCTGTTTCAGCTGTGAACTTCTGCTTTTC
AAGTTTTTGTTTTGTCACTAACCAAATGTTTCTTAAATTCTAGTGAAGGGAAGAGGGAGG
CAGTTGATGATGTTTGTATTATCCACCCCATCCGTTTCCTGTAAATGAGAGCAGTTTCCA
CGTAGTGTCTTTTGCCTATGTAGTCAAAAGCACCATACAAATGTGGGCTCTGGTTCTTTC
AGTGAGAAGAGAGTTAAGAATGCACTTTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved