Homo_sapiens Locus Mono:150:AC007610.10
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:150:AC007610.10
Homo_sapiens
Mono:150:AC007610.10
16
SNORA70EL4
1001..1131
2131
CAGCCTATAACACTTTTTCTGGTGGCGTGGGGACACGCCCCCTGCCCGAGCGTGTGCCC
CGGGGTCCTGACGCGGGCTGCGCGAGACCCTGCACGGCTACGTGTGCCCCGCCCTGCTGC
GCCCTGGCCGGGGTGGGGGACCCCTCACCCCGGCCTGAGGCCACAGAAACCTGTACCCCA
TGCATAGCCCTGGGGGAGACCACTAAGACTGAGAGTGTGAGCCAAGGGCGGAAAGCCGCA
GCCGCACACTCAACCCACTTTACAGGGACACGCAAACACGTGTAGATGCACAGAGAAGCA
GACACACTCCTGCGCGGCGTAGCAAAGACGCTCTCCTGCCCTAAGGTGCACCAACAGCCT
TAGAAAGCTCTTCTGAGTTCAGCATTAAATTTTAAGAAAACCCAAAACCTTTTAATCCTA
AAATGAAGATTTAGCATCAGCAAAGATTGTCCACTAGGTCGTTATTTGCATGTCTTTCAA
ATCTCAGTGGTTAAAAAGCCAAGGAAAGGGGAATGTTAAGTATTTTAAATCAAGAGACTA
AAAGAAAGTAAGTGAACAGCTTCTATGTGGGCCCTTTAAGGTTGGTCCAACGTCCAGAAC
AAGTCCCTGATGCCTGATATTGGCCTTCCATTTTGGGAGCTCAATATCCTGGAAAGTTTT
TATGACAAATAGTGGAAAACTATCAAAGAACTAAGTGTCGCTCTACCTTTTTCTTTCTTT
CGAGACTAACTCTTGCTCTGTCATCTGGAGTTCAGTGACTCATTCACAGCTCACTGCAGG
CTCGGCCTCTTGGGTTCAAGCGATCCTCTTGCCCCAGCCTCCGAGTAGCTAGGACTATAG
GCACGCGTCAACATGGCATAGAGACGAAGTTGCTCTGCGCTGCCCAGGCTGGTCTGGAAC
TCCTGGACTTAAGCGATCCTCCTACCTCAGACTCCAAAACTGCTGGGATTACAAGGGGGT
GAGCCACCACGCCTGACCTTACTTTTTTTTTTTTTTTTGGTAAGAGAATAAATAGCACGA
CCAGAAATACGGAAAACACACAAAGACCCTTCAGCTGCAAACAACAGCTTCCTTGGTAGT
TTATGCAGCCTGTTTCTTGTATGGGCTGCTCTAAGGGACCATGGAGACAGGCCTTTCAGA
TGTATGTTCATGTCTTTGACCTTGCACTACGCCAATGTAGGCTCCAGGCAGATATTCGAG
GTGCCTTTGAAAAGCTCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGT
CCATCTGCAACAAGCTGCAGAATAAGGAGCATGTGATTGAATCCCTGCTCAGGGCCAAGT
TCAAGTTCCCTGGCTGCCAGAAGATCCACATTTCAAAGAAGTGGGGCTTCACCAAGTTCA
CTGCGGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCGCAGATGACTGTGGGG
TCAAGTACATCCCCATCATGGCCCTCTGGACAAGTGGCGTGCCCTGCCCTCGTGAGGGCT
TCCACTGTGCTGCCCCCTCTTAATACTCCCCAGTAAATCCTACTTCCTGTCCACCAAAAA
CAAACAAAAAAAACCCTTCGGAATTTTGATTCATTCAATTTGATTGTTGCTGTTGCTTTA
CTAGAAATCAGTATTAAAAGTTTTCTCTGTCCGGGGGCGGTTGCTCACACTTGTAATCCC
AGCGTTTTGGGAAGTCAAGGCAGGCAGATCACCTGAGGTCGGGAGTTCGAGACCAGCCTG
ACCAACACGGAAAAACCCCATCTCTACTAAAAATACAAAATTAGCCGGGTGTGGTGGCGC
ATGCCTGTAATCCCAGCTACTTAGGAGGTTGAGGCAGGAGAATCACATGAACCCAGGAGG
TGGAGGTTGTGGTGAGCCGAGATCTCGCCATTGCACTCCAGCCTGGGTGACAGAGCGAGA
CTCCATCTCAAAAAAAAAAAAAAAAAAAAGTTTTCCCTGAATGAAATTTGCTATGTACTA
ATTATTACATAGCCAGGAAAATAAGTAGCCGTATTTTTTGTGTTATTTACACTGACAAAA
ATAAAACATTGTATAGAAATAGATTTTGTTTGCTGACCTCATATTTGTTTTAAAAATTGA
ATCTCTGGCCGGGCGTGGTGACTCACACCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved