Homo_sapiens Locus Mono:176:AC069224.16
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:176:AC069224.16
Homo_sapiens
Mono:176:AC069224.16
3
SNORA72L2
1001..1132
2132
TGGTGGAGACAGCCATTGTTAGGCAAGTGTCTTGTGCAAGTGGTTTATCTGGAATACTG
TGATTTTGAGGAATTTCTTGCAATAATTAGTGCTACAAACTTAGGTGCCTGAGGGCTTCT
TCTCCATAGCCTCCTGGCTCCATTTCATTAGATTTGACGTAAGTGACTTCATTTTGACAC
TGATAACTTCACACAGTCAGACATTATGACTGTCTCAAAGAATCTTAAGAAGTACATAAA
TAGGCAGTAGTATTCTGGAATGAATTTCCTCCCCCATCCTCTCTCTCATCCAGTGGATAA
ACAAGATCTTTTGACTCAGCTTCCAAATTGGATTAATCTTTTCTCCAGCTTCACAAACAC
CATCTTACTCTGAGCGAAATCATCTGTGGCTCTGACTATTGCCCTCCAGTTGGCCTCACC
TTCTGCCCCCCAAATCTGTTTGCTAGAGTTTCCAAAGTGATCTTTTTTTAAAAAAAGAAG
AAAAAGAACAACAATAAACTAGATCATATTGCTTCCCTTTGTAAAATCTTCCAAGGGCTT
CTTTGCTTGGAGATTTAAATCCACACTCTTTGTGCTTGCTTACAAGGAAATACGTGATCT
ATCTGTGCCGCTTCTCCAATATCATGTACCACTCTGTCTCCCCACAGTGCTCCAGGGCCT
TCTGCTTAGAATGCTCTTCCTCCTGAATTTTCCACTGTCATCTCCTTTTCATTTTTAGAT
CTCAGCTTGAATATTGCCTTCTCAGGCCTTTCCAGACCCTGCATTCTAAACTGGCCACTC
AATCATTCTTATTTAAAATGCTAAATATCAATCACTTTGATACAAGATTTGTGTATTGTC
CATCTCTCCACCCCCAATTAAAATGAAAGTGCATAAGTTCAGCAAGAAAAGCTCTGACTT
ACGCTGTTCACCAATGTCTTCTCAGCTAATAGGACGCTTAATTGAGTTCAGCATGTTATC
TATTCATGCGTTGGGGTTTTATCACTTAAATTAAGCAGTTACTGTGAATATTCTCGCTGT
TCTGATTTTGTAATAATCACGATGGGCTAAACATTCGCAATATTAAGACCATGTATGTAT
CCCTAGACCTAGTTCTTTCCCCAGGTCTGGTTTTATAAATGCTGGTGATAAACCAGGTCT
GATATATTATATGATCATTTTGTGCAATCATATAATGGCTGTGATTCTAGGTTATCTTTG
GTCAACCTTAAGAAAAATGACAGTACAGCTAACATAGTAACTTTTGCAAAAAATCAGTGC
TAATTTGCAGACTGTTGTCTAAAGAAGGGATAACCAAAGTATAGAAATTTGATGGTACCA
GTTGCTATTAAATGAATTGTAAAAATTACTGTATATAAAAATTTAAAAATAAATAAAAAA
TAAGCAGTTAATCCTCATAACAAAAGGTTTAATTATTTAAAATAAGTACTACCTTAGATG
CATTTACAAACTATATTAGATTATTTTATGTGAAAAATACCTTTGATTAAAGAAAAACAG
TGTTAAAAATATTTTCTGTGCTTGATTTCCAAAGGATATTATTGAAGATGATATTTTCAA
GGATTCTAATAGTTCTTTTTCTCCTTTAATTGCTTAGATCATAATCTAGAAAAATAATTT
TAGGTTAATAATCCAATCTAAATTTCCTAGAATGGAACTTAAAAACTCACTATTTAGCAG
ACATTTTTTGCTCCATCTCTGGCCAATCTCCAGGTTAAATGAGAGAGGATTCTAAATAAG
ACCTGGTGAAGGTGACATTTGAGTTTGGTCTTTCAGTATGAGTAGAGTGAAAATGGAAGT
AGGTGAAAAGCAGAGAAACTGGTACTTTAGGCAAAGGCGTGAATTCAGGTCTTGTTCTGG
AGATAGAATATAAATGAGATTAGCTGGAAGGGTTGGTGGGAGCCAAAACATCAAAGGCTG
TAAAGCTGAGGAGTTAGGGCCTTACTCAGCATGGGAAGCCAACAGATTTTAGACTGAGTG
CCATGTTCCTGTGTTGTTTGTGTTGTTGTAATGGATAAGATTGTGCAACATTAGCTAAGT
AATGGACAAAAATAGACCCCACATACTTAATCAAAATCAATAGGGGCCAGGTACTAGTGA
TTATGGAAAAAAGGAGTTTCCAGTAGACCTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved