Homo_sapiens Locus Mono:93:AL078599.19
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:93:AL078599.19
Homo_sapiens
Mono:93:AL078599.19
6
SNORA70EL7
1001..1133
2133
TCAAGGTTGAGACTTGGAGGAAAAAAAAGTAAAAATACTTAGCACAAATCATTACTGAG
GAATTAAAAGGAATCAGAAAGATGGGAATCATTGGGAACAGCACTCACAGTACATGTTAG
AGCTTTGAAGAAACACTCCCCTAGTGCTTAGCTGAGAAGGGATAAGCCCAAGATTGTGAC
AGAAGGCCAGGCTGGAAAAACAGAATGGCCGGTATTAGATGAATGTAAATATGTAAATAT
GCCTTAGAGTATGCCTTAGAGCATGCTAAATGTGCCTTGAAACATGTAAAGTATGCCTTA
GAGAATGCCTGGTCCTTTGTAGGCACTCAGGCCAGCTAACTCATCTGCAGGAGCTGGATA
GAATGTAATGCTTAGGCATGGAGACCAGCAAAGGCAGAAGAAGGGGCAAAACCCAGGTTG
CTCTCCTTCTAGGCATCAGGCCCATGGGAGTTCAAAGATGTTCTCAATCTTACACTGTGG
GAGTTATCTCTCAGGGCATCCAGTTTGAGCCTAAGGCAAATTTGGCTGATTCCAAGTTCT
ACCTGAACTCAAAAACAACTATTATAATATATCCTGCATCTCCATCCTGCAACTGGTGGC
TAGTGAGGAGTGATACCATGTGAAAATATCTGTTTGTAGATTTGGAACTGCTGCGGCAGA
AATAGGGACTTTTAGTCTCTAGGACAAAGAAGCTTGCAGGTCCCCTTCAACAGTACTGCC
CTTGTACAAAGCCAGAAAATTATCTGTGATCTTTATAGCACAGGAAGGACCTCCAAGCTA
GAGAAGGGATGGTTCAAGGATGGAAACATCTTTCTTATTAAAACACCACATAAAATTCTG
TGAGTTCTGAATCAAGAAAGAACCTCCAGCTGGTGGGAGCTGACCCCACCAGCAACCTCT
GACTCTTTTCTATGAACACTGCCTTTCTCTAGAGTTCTGTCACTCTGATTACCACTGTCA
CCCCGAATTCTGGAACTCAGCAGACTTTTAAAATTATTCATCTGCAGTCAATTAAGCCAG
CTGTACTCCTTTCCTCACAGGGGCTCGGTGTAATGGCTGCAAACAACAGCCTCCTTTGTT
GTATACACAGCTTGTTTCTTGTATGGGTTGCTCTAAAGAACATAGGAGACAGCCGTTTCC
AATGTATGTTTATGCCTCTGACCTTTGACCTTGCACTGTTCCCATTGTAGGCTCCAGACA
GGTGTGCAGGGTATCTCTAGAAAGCCCCAGGGTACCATGGCCAGAATTTACATTGGTAAG
TCATCATGTCCATCCATACCAAGGTGCAGAACAAGGAGCATGTGACTGAGTCCCTACACA
GGGCCAAGTTCAAGTTGCTTGGCCACATCACAAAGAAATGGGGCTCTATCAAGTTTAATG
CAGATGAATCTGAAGACATGGTAGTTGAGAAGTGTCTTATCTCAGATGGCTGTGGGGTCA
AATGCATCCCCAGTCATGGCTCCGCAACAAGTGTCAGGCCTTGCACTCAGGAAGGCTTCC
ACTGTTCTGCTGTCTCTTAGGCTCACCAATACTTTCTGACAAAGAAAAAAAAATGTTAGC
ATATGTTTAACCAAACCCTTTCTTTCCTTCATCCTTCTTATCAAAGTAGAGGCATGTAGA
ATTTTCCAAATTAATGTAATTCGGTATTACACAAAAATGAAAAGGCAGGCATTACAGGCA
AGCTACATTGCGTAAAGTCACAATTCCAAAGTTTTAAGTCCTTGATCCTAAGATGAACAT
ATCCAGCCCTAAAAGACTTCACTATCTCTTGCTGTGAGTCCTCCACCCACCCCCATCCTG
CCTGTTATTTGGTCAGTTTTCTAGCTGTCATATTTTCTTTCCATCTTTCCAAGTGTGGTA
AGTGTTCAAACAATGGGTTGAAATAAAAAATAAGAAGGAATGATCCACTGTAACTGGGAT
GGTTAAAAAAGGTGTCTTTGTAGAGAAAAGACCAGACTAAAGAGTAAACACCAGCCAGTC
ATGAGAAGTTGAGAAAAGAGTGTTCCTGGCAGAGGGAGCAACTTGTACCTGGGCAGGCAA
GAATCTCTTGTACTGGAGGAACTCAAATGTGTTCTATGGAACCAGAGCATGCAGAGGAAG
GGAGAGATGGCATGAGATTAGGCTGAACAGAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved