Homo_sapiens Locus Mono:310:AC103710.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:310:AC103710.2
Homo_sapiens
Mono:310:AC103710.2
11
SNORA62L4
1001..1153
2153
TACAATTTCCCCTCCGATTTTAAGCCTGCAAAGAAATATACAGTGTTGGTTGAATGTTA
TCTGTAGGCTGCTAGAAACTGGAAATTATACCAGAAACTGCATTCCACATAATAATGCTT
ATTGGGATAGCAACCATGAGCAAGCCCCATACATAGCTTTTAAGAAAAAAAATAAAAACT
GAAGATGTCTTGTTTTGCACTAGAGAGTATATAAAGAAAAAAATACTAGCATAAATCTTT
AAAATATTTCATTAATAAAGGAACAACATCTGGAAAATCCAGAGCATGAGCATATATGAA
GAAATGTAATAATGTCTGTAAACTATGTAGCATGTTGCCTATCACATCACAATGACTCAG
TTATCAGTATCTCAAATGTAAAAACTTCTGCAGAACTAACAAGAAAACATCCTTAAGGTA
ATGTAGGTAATAGCATCATATAGCATTATGGAAAAACAAAGAACACATTGGAAAAATGTC
AAAATAATAAAATACTAAAAAATAGAATTAAAGTGCACATTGAACATAATCAAAAACAGA
GTCAAGGGACAGTAATTAACTTAGTTCAATTTGGAGAATGCATTTGAAAAATTCTCTCAT
AATGCATAGAAAAAATACGGTGCAAATAAAATAATGAGAAAATTATATTTGGGAAGGGCA
CAAAATGAAAAGCCAACATACAAATAACTATAGTCTCAGGTACAGTAAACAAAAATAAAT
ACAATAAAAATGACTGTTCCAAAGGAAAGACTCCAGTGTATTGAGGATGAAAGGGCTCAT
TGTATTCAAGGTAAAATCAGGAAGATAAGAACAAGCATAAAATATTTGACTTAAATAAGT
TTTTTTTTTAAATTACAAGCTTTCAGGCAGAAAATATGGATTTCCTATAAAGAAATGGAA
ATTAAGCCGGTTTTACAAAAAAATTAAAATATTAAAAAAGTCCTTTATAAAACATGGCAT
TCATGACGCAGAAAGAATAAAATATGTGAAAACAGATGGAGATTGCACGTTGTTGGAGCT
TGGAGTTGGTGCTCTAACTGGCTGATAAACTTGCAAGTGTAGGTAGTATGCTATGTGAGG
GGCAAATTTTTCAGTAACATGACAAAGGTCTTTGGCCTAGTGAGTAGAGTTTGACAATAA
TCCTCGCTGCAAGTATAATGTTAAAAAAATTACAAAAAAAAAAAACTAAGACACTGACGA
CTACAAAGCTTTGCTGAGAGATATTTTAAAAGATGTAAATAAGTGAAGAGACATCACATG
TAAATGGATTAGAAGACTCAATAGCATAGACATGGCTGTTTTCCCTTAATGGAGCTATAA
ATTTAATGTAATATCAACAAGTCTTTTTTTTCTGTAAAAACTGACACTCATTCTATAATT
TATACGGAAATGCAAAAGACTTACAATTTTGAAATAGAAGAAACAACCTGGATTGAAAAC
TTAACATTAAACCAATGCAATTAAGACACATAGCATGAGGACAGTCATACAGATTAATAG
GACAAATTGGAGAGTCCAGATTTAAACACCTACATTATAGCCAATTGGTTTGTAATAAAG
GTGTCAAGACAATTAAATGAGAGAAAGGATAGACTTTCCAATAAATGGTGCTAGAACAAT
TAAATATCACTATGAAAAAAAATAAATAACTTGGATTCTTAGCAAGCACTGTCCTAAAAA
ACTAGCTCAAAATGGATTACAGACCTAAATGTAAGAGCTAAAAATCAGAAACTTCTAGAA
AAAAAATCGGAGAAGATTTTATGACCTTGGGTTAGGCAAAACATTATTAGATACCATATT
AAAAGTGTGAGCCATTAAATAAATGATCAATATCAGACTTCAAACAAAAAAAAGTACAAT
TTAAAAGTCACCATTAAGAAAATAAGAATAGAGAAAACAGACTGGGAGAAAATATTTGCA
TAAAAAACTCATATACAAAAAATGTAAAGAACTCAATAAAGAGACAAACAATCCAATTAA
AAATGGGCAAAATATTTGAATACACATATCACCAAAACATATATAAAAATGACTAACAAG
CCCACGAAAGTTGAGAATTAGGAAAGTAAAATTAAAATTAAGAAATAAAAATTTAAACTG
CTATAAAATACCTTTATCCACCCACTAGAATGGCTATAAATAAGAAACAGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved