Homo_sapiens Locus Mono:146:AC008915.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:146:AC008915.11
Homo_sapiens
Mono:146:AC008915.11
16
SNORA75L3
1001..1124
2124
TTTGGGTGAAGTTTGAGGACTGCAAACCAGAGTCATGGATTCACGCTGCCCTGCATATA
TGCTCCGGAACAGATACTTCAGAAAACCCCATCAGTCAAATGAAAAACAAGCTTTAGAAA
AACCACACATGGCAGGAGGGGACTGAGAGGGAGCAGGCAAACATCCAAAAGAGACCAGAG
AAAATATGATATATATGGAGAGGGAAAAAGGAGAGCTAATGAACAGATAGTTGATGTTCT
CAAAGACAGAAAAGAGAACAAATAAAACAGAAAAAAAAAATTTTTAAGGAAGGTGATTTT
CTATAAATGAAGATATGAATTGGTAGGTGAAAAGGGCTGACGCTGGGTCCTGGAAAAGTT
AAAAATTTTCAAAACTGAAAAAGAACCTAGAGAAGTTACTAAACTACAAGGTAAAAGAAT
CTTATAAGCCATAATTTGGCAAACTATGCGCCAGCAGGCCAAACTGCCATCTGTTTTTGT
AAATAAAGTTTTACTTGGCCAGGCATGGTGGCTCGCGCCTCTAATCCCAACACTTTGGGA
GGCCGAGGTGGGCAGATCACTTGAGATCAGGAGTTCAAGACCAGCCTGGACGACATGGTG
AAACCTCATCTCTACTGAAAATATAAAAATTAGCCAGGTGTGGTGGCGCACGTCTGTAAT
CCCAGCTACTCGGGAGACTGAGACAGGAGAATCGCTTGAGCCTGGGGGGCAGAGGCTGCA
TTGAGCTGAGGTCACGCCACTGCACGCCAGCATGGGGAACACAGCGAGACTTCGTCTTAA
AAAAACAAAAAAAATTTACTGGCACACAGCAAAGCCCATCCATTTACGAGTGGGCTTTTG
TGCCACAACTGCAGAGGTATCTGTGAGAGAGACCACAAGGCCGCCAAATACTAATATTTA
TGATCTGGCCCTTTACAGGAAATGTTTGTCAGTCCTGTTATAACTATTCAGGGAAAAGAA
ACAAGCTACATACAAAAAAAAAATAATAGGAAGAAGCAGCAGGCCAATCTCATACTTATC
AGAATATAGAGGGAAATGCATTCGCACTAGAAGACAGAATTCACAGAAGTAGCATTTCAC
CTTTTGCCTTTACAGAAGTATATTTGGCTGTTTTGTGAGACATTCTGCGGGAAAAGAAAA
ATAAATATAGATGGCAGAAGACAATGAAGAATTCTGAAGGAGAAAGTGTGTGACCCAAGA
ATTCCAAAAGCAGTTATTGCTTTCTACACATAAAAGCAATAGAAAGACACTCCTGGCCGG
GCGCGGTGGCTCATGTCTGTTAATCCCAGCACTTTGGGAGGCCGAGGCGAGGGGATCACC
TGAGGTCAGGAGTTTGAGACCAGCCCGGCCAACATGGTGAAAGCCCGTTTCTATTCAAAA
TACAAAAATTACCTGGGTGTGGTGGCACACGCCTGTAATCCCAGCTACTCGGGAGGCTGA
GGCAGGAGAATCACTTGAACCCAGGAGGTGGAGGTTGCAGTAAGCCAAGATTGCGCCACT
ACACTCCAGCCTCGGTGACAGAGAAAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAATTA
CAGAGTTCCTTCTAATCTATGTAATTCAATCACCATTAAGACATTCTAAAAACTGAAGAC
TTACAAGGCCTTATCTTTATAGAGAGATATACACAGAGATGAGAAGCAGCTAGCACTCAC
CTACAGCCTGAGAGGTGAATGCCGCTACAATCTGTGGACTGGCTAGGGCCTCCAGCCTGT
TCTTCAGTGCCTCCAAGTGCACACACTTTTCTGAGTAGTCTGGTGTATCAACAAGCATCA
TTAAGCTGTTCTGCATACCTGTTAGCTTGGCAGAAATCACAGCTATGTCCTAGAAAAGAC
CAGAATAGAGAATATTTATTTTAAATGATCCCTACTGCCTCAATTGGGAATAGATAAAAT
ACATGAAAAGGCAACTCATCAAGTATGAAAATGGGGCTGGGCATCGTGGTGGTTCATGCC
TGTAATCCCAGCACTTTCGGAGATTGAGGCAGGAGGATCCCTTGAAGCCAGGAGTTCAAG
ACCAGCCTGGTTAACATGGCAAGATCCAGTCTCTACAAACAGTAAAAATTAGCTGAGTGT
GGTCATGCGCACCTGTAGTCCCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved