Homo_sapiens Locus Mono:83:AL645936.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:83:AL645936.5
Homo_sapiens
Mono:83:AL645936.5
6
SNORD32B
1001..1082
2082
CTTGCCCAAAATGCCACACTGTATCTTTTCCCACCACTGATACCTTTAGTGCCCCAGAG
TCTATTGAGTCACATGACCAAAGCACTACCACACGGCTGATATGACAGCTTAGAACAGCT
GCGGACCCCAGGTCTGCTCTGGGCTTCAGTCAGTCGCTAGTAAACTGTTCCATGTGGTAT
TCCCATGAGTGTGGAATATGTTTCCTCTAGATCCTAAATAGGACAACCAAGCATTCTCTA
CCCTGGAGAAGAGGAAGGAGAAGACCAAGATTCACTGCTGGAAGAAGAAAACAGCCTATG
AGGCTACAGAAACAGGCAGAAAAGAACGTGGAGAAGAAAACTGACAAATACACACAGTTC
TCCTCAAGACCTATGGACTCCTGGTCTGAGCCTAATAAAGACTGTTTATTCCAAAAAACA
CCTCTGTATTATAAATTCTTCTGTGTAATAGTGTGTTACTGTGCATCTCTTTCCAATTCT
GCATTACTGGTGTTAAGTGTGAAATGCAATAATGTGTTCTTACTTTAGAGGGATGTCCTG
GCACAAAGTCTAAAAACTTCAAAGATGTGGAGGATGCTGAATCTTCACAGGGTGTATTTC
CCACTCTCTGGAGTGCATTTGTCTTACCAGTGCCGCCAATATGCTTGCCCTCATGGCTCA
TTCTGTTTGGTTAATAAGATATTGTTGATACAGTGGAACGATGTCATGTTTTGTGGAATG
TCCAGAAGGTCCACGTCCAGTGGTGTGCTGCATGCAGCTAGCTCATACTGCCTCATGGAG
CCAACTGTTAAATTTTCAGAAATTGTGCAAACCAGTTGTTAAACATGACTATTATTTTAA
AATAAGTTATTTTAAGGCATAGGTAACAAATCCCTAAGCTCTTCATTTTCTAGGTATTTA
ACTATCTTATCATATTTTCCATACTCTTCTGGTTATTTATATCTGTTATGTCTATATAAT
AAAGATACTAAATAATGTTGTCTGTATAATAAAAATATTCTGGATTGGTGATGAGCAACA
ATCACCATCTTTCGTTTGAGTCTCATGGCCATGAGACCAACCCCATGCACTGCTCTGAGA
CCTGCCAGCCACTCCCATTCCTGGGGTGCGGTCCTCCTGGTTCAGAAGTGATTTTCCATT
AGGCTATCTTTTAATTTAAACATGAACTCTGCTGTGCCCATCACTGTCTGTGTGCAGTCA
CAGGTAGAGGGAGAGCCTTCAGATGGCACCCTCAGCACTTCCCAACCCTTTCCTTCCCTC
TAGGCCAGAAGGTGGTGGTCGTACAATGCGAGAGCATCAACATTTCTGGCAAGTTCTACA
GAAACAAGTTGAAGTACCTGGGCTTTCTCCGCAAGCGGATGAACACCTTCTGGAGGCCCT
GCCATTTCTCGGCCCTAGCCGCATCTTCTGGTGGATGGTGCAAGGCCCACTGCCCCACAA
GACTCACCAAGGCCAGGCCGCCCTCAACCACCTCAAGGTGTCTGACGGCATTCCACCGCC
CCATGACAAGAAAAAGCTTTGGTGGTTCCTGCTGCCCTCAAGCTTGTGTGTCTGAAGCCT
ACAAGAAAATTTGTCCGCCTGGACACCGAGCTTATGAAGTTAGCTGGAAGTACCAGGCAG
TGACAGCCACCCTGAAGAAGAGGAAGGAGAAGGCCAAGATCCACTACCAGAAGAAGAAAC
AGCTTATGAGGCTACAGAAATAGGTGGAAAAGAACATGAAAAAGAAAACTGACAAATACA
CACAGGTCTCCTCAAGATCCATGGACTTCTGGTCTGAGCCTAATAAAGACTGTTTGTTTA
TTCCTCAAAAACAAACAAACAAAAAAAAACCCTCTGTATTATAAATTATTCTGTGTAATG
GTGTGTTACCATACATTTCTCTACAACTCTGCATTTTCAGTAATCTCACATTGACAGTTT
AAAATTGGCCATGGTGAGAATATTTACACTGCAGAAATCAGCAAATGATGTAAATCAAGG
CTTTTTTGCCTGGACTTGCAGCACATCCATGTCCCATTGGACCCTATTATGACGGGAGAG
TTTTAACATGGTACTGAAGCAAAAATGTAAATGTAAATGTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved