Homo_sapiens Locus Mono:140:AL136367.10
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:140:AL136367.10
Homo_sapiens
Mono:140:AL136367.10
9
SNORA26L3
1001..1136
2136
AGGACCAGCAGGACATTATTTTTGCATTGCCACATCCTAGTAGCAAAGAGAACAAAATG
TGTGATGAATGCAGAATCTGAAGATGGTATTTTTGTTCAAATAAGCTTTATTGTCCCTTA
TGTCCACTGTCCTGGTACCCTGGGTCCAGGAGACGTGAGGAGCCACAAATATCCCCATAG
GAGTCCCGCACTGCACTCCACCTCCCAGCAGCCATAGGCAGATGAGAATCATTTTTCATC
TGCTATGCAGTCATTTTGAAAGTAACATGATAGTCCCTCTGGGGGATGCACATGAAGCCA
AAGTGAAACAGTCTTTTCCTTCTGACTGCGACTGCAGCATTTTCTTTCCCTGGCTCTCCT
TCTTAGCATAAGCGTGGCTGAGTCTTTTGTCTTTTGTTCAAGACACCACACCTCAATCTT
AGACTCCACAGTGTTCTTGTTGTTGCTTTGTTTGTTTGTTTTGATATGCATCTTCTCATA
AAATGGGTCAGGTTCAAAAGGTACCGGCTCTTTTCCCACATCAGTGTCTGTCGTGGGTCC
AATGTGCCCCAGGTGTGGCTTCGTCAACGTTCCGTTTACACATGATTCTCATTACAGGAT
CCCCAAGGGCTGTGAAAACATTTTCTTGAGCCTCCCCCAAACAGCCACAACTAGGAATTG
GCAAACACCAATTGAAATGCACCATTTTAAATGTATTATGGGCAGTCAGTCCCCCACCCT
GACGTGTACTCAACTCCACACATCCTCATTGCCTGCCTGTCCGGGACCCCAGGTCACCTC
TTAGCTCCTCATGTTCCTCGAGCCCCCGGTATCCCCTTGGCCAGGCCCCAGATGTTTGGA
TTGCAGGCACAGGAGCGCCAGTAGCAGAAGGGACCATGCCAACGGGAGGACCCATCAGGC
CTCCAAGGCCACATCATCATTCCATTCGCCGGCTCATGCGTCAACTTACATGACTTCTAT
GTGGTTATTTAGCCTTTTAAAAATACTTTTCACCCTTTCCTGTGCCCTTTTAAGGTAGAC
GCAGTTTCGTAAGAGGCTAACACATAAGGGTAAATTAAAGTAAGTCTCCATAAAACCCAG
AGAAGAGACAGAAGAGACTGTGAAACTCCTCTTTGGACCCCATCTGGAGCCACAGCAAAA
AAAAAAAAAAAAAAAAATAGTTTTACTTGCTAATCCTTTAGCTAAAAGCAATTCATAGAA
GAGAATTGACAAGCTCACTAAGGGAGAGAGAAGTAGCTTGTACAAAGACTGTGCCTCAGT
TTCCCCATTTGTAAAATTAAGGATTAGACGTGATAATCCCTCAGCTACCTCCATCAGTGA
AATATGATGATTTACTGAATACGGGCCATTTTTTAAATGAAATAAAATTGTGAATTTAAA
TTTATTAGTAATAACATTCTGTTTTTTTATGAAGTAGATAATGACAAACCAAAATATCTC
ATTTGTTATCAACAAAAATAAATCACCTTTAGAGTGGGGATGAAGGGCAAAAACTTTAGT
CATGTATAGTACATGGAATAGGGATCAAGGTGATGTATATTTGGGGGAACCATTTTAAAG
AATCGAGCATGAAAAGTATTCTTACAAAAGGCAAATGCGGGCTACCTGATATAGTCACCT
CCTTTTCTGATTCCAGAGGTCTGAAAGCAGCCTCAGCAGCAAGCCACAGCAGACGCGAAA
CGGGGAAGAGCAATGGCATCGCTGGTGATCAAAGGCCTGGCCGAGCTACCCCAGGCTCCA
TACCATCTCCGGAGATGCCTGGCTTGGGGAAGGTCCTTGGTAAGAGAAGCAGTTCTCAGC
CTCTTTCTCCGGTCAAGCTCCTCTACAGAAACAGAAAGGAGAATAAAACAGGGGCTCAAT
ATGGATCCCAGTTACATGAGCTTATATCCCAGCTGGGTTTTTTAACTGACAAATGAAAAT
GTATATAAATGTATGGTGTAAAACCAATATGTGGCTGGTCATGGTGGCTCACACGTGTAA
TCCCAGCACTTTGGGAGGCCAAGCAGGCGGATCTGTTGAGCCCAGGAGTTGGAGAAACAT
GGGCTGGGCAACATGGCGAACGAAACCCTGCCTCAAAAAAAAAAAAAAAAATTACCCAGG
CATGGTGGTGCAAACCTGTAGTCCCTGCTACTGGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved