Homo_sapiens Locus Mono:112:AC104701.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:112:AC104701.5
Homo_sapiens
Mono:112:AC104701.5
4
SNORD75L1
1001..1058
2058
CATGAGAATGTGCTGCTACTTTTAACCCTCCAGACTGGGTTTCTCCCCAACACAAGTGA
CCAAGCAATTGTTTCTGAAGAGTCTTGAATGATATCCACATGACCAGTTTCTCCATTTTA
CATGATAATGTAAATTAGTACTAAGGGGATGTCTTTGGTTAATTACTGCAAACATTTGAG
TCTGCAAACTCACCCCTTACAAACTATATGACACTGAATACTAGATTAAATGTGAATAAG
GCAAAAGATGAATGTTTCCTCTACTATCCTAATGCAGGCCAGTCTCCAGGCATACTTTTT
CTGGGGGGAGAAGGGGGTACAAAAAAAAAAGACAGAGAGCCATTGGGAAATTCACAGGGT
AAGTTAGGGAGGTGAGAGGATACTGAAGGTTTTTGCAACTACCCATTTTTGGAGGGTGGA
GCAGTTTTTTGGTTCATCTTTGCACAGAGTCCTCAATAAAAGTTTATTGAATTAATTAAA
GGAGACAAATATGACAGCCCTTCAAATACTTAATATTGTTATATGGGAGAGGCATTAATA
AGTCTTTCTGTAATAGCCACTTTTTGTTCTTACTTTTATTCCCTTAAAGTCACACAGAAT
AATAAATGGGAGAGTTTCTAAATTATTGGAATTGTTTAAAAATTGACCACGTAGAGACTT
TTTTGCTATTACTTCTGGACAACCACAGAAGAAAATATGCTTTCTGTTGATGATCAGGCT
AGACGACCACTAATTAGCCTCCCAACTCTGCCGTTTAGAATTATAGGATCTTCAGTTTTC
ATTTTCATTCAGATACTTATGTTCGTATTCATTAATCAAAAATGTCTTCAAAGTTTCAAA
GAGTTAAATTATAACTGAAGGAATTTGGAGACAGACCTGTCTCCAGGGCTGTTTTAGTAA
ATTAAGGTATACCTGTATGTTGGAAAACCTAAGCAGGCATAATATGTGTTTATGGACCAA
GAAAAATGGTCATAATATAGCATTAAGGAAAAAAAAAGTTAGGCCAGTGATGGTTTAAAA
GTAATGGACAGAAGGTTTCTGAAATTCTATTTTGAAGTTTTAATGTTTAAAAAATGTTTT
TATCAAGTATGTGTATGATATATATAAATAAACTAGGACTAGAAGAAATGTAACTTCTAA
TTTTCTTATCTGGACCAATTTACTTATTTGGCATAACTGAACAACAGCTCAACTCTTAAC
ATAATTGAGCCTCTTTTATTCTGCAGAAAGTTTGATTCCATTACCCTCTCACCTTGAAAG
AAGGGAAATAGTTTGATACTGAAGGAAAGGGAGGAGTCTACCCTTGTCCTTTGTTTCCCT
CATCATACACTTAGTCTTTAAACTCTCTTTACCTGGAGAGACGCATTTTAGTGGAGTAAT
GAATCCAGAAACCAGAGATGGACTGTCTATTCCCAGATATCAAATTAATGATCTTGGTCC
TTTTTTTCCTCTACCTTTCTATAATGCTCAGCCATGATAAGCATCCATTTCTTTTGAAAA
GTCTCTGTTCTCTTGGCTTCTGTGAAACTTCAGAAGATTTGAAGATAATGTAGGAAAAAT
AATTTATATCTTGTTCATTTTCTCTGTCCACTGGTCTTGAATTATTTCAAGCATCAGCCC
TACTTGCTTTCTTTCCTTTTCATTTTTTCCATCCATTATTCCTATTTAGATGACTCCCTA
ATGTCTGTCTCCACTCCTAATCTCTTTTAGTTCTCTATTTCTAACTGCCTCTTGGGAAAT
TCTTGGGCACACCTAATTTCACTATCTTTGAAACTAAATGAATCGTTCATCATTAGTCTT
GTTCCTCCTCTTGTGTTTCTTAGGTGGGGTGAGTAAAAGATTCCAATCAAGACTAGTTTA
AAGTTTGAGGAGCCATGGAAAGAAAGATCAGTCAAGACCACTAGGACTTGAGAACTCCTA
TCTTTCTCCTCTCCATTTTATTCAGTACAGACCCATTATTACTAATTTAAGTTGCACAAA
AGGCTATCAACAGTCTATTTACTGTGCTCTTTTATAGTTTTATTAATTTTATGGAACTGA
CATAAGTTCACCACTAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved