Homo_sapiens Locus Mono:261:AC007952.15
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:261:AC007952.15
Homo_sapiens
Mono:261:AC007952.15
17
SNORD3@
1001..1216
2216
TCATTGCACTCCAGCCTGAAAAAGGAGTGAAATTCTGCAACATGTTACAACGTGAATGA
ACCTTGAAAACGTCATTCTAAGTGAAATAAGCCAGATACAAAAGGACAATATTGCATGTT
TCCACTTATAGAGATACCTACAAGAATCAAATTCATAGAGACGGAAAGTAGAATAGTGGT
TAAAGGGGTCTGGGCGGAGGGAGGAAAGGGAAGTTTGTTTTACGGGTAGAGTTTCAGTTT
GGGATGTCGAAAAAGTTCTGGAGATAAATAATGGTGATGGTTACATGCCAATGGCTACAC
GAATGTACTTAATGCCACTGAATTGTATATGTGAAAAATGGTTAAAATGGTAAATTTTGT
ATCTATTTAATACCATCCCCCCTAAAAAAAAAATTGTTTTTAAGAGTCAAGATCTCACTC
TGTCTCCCAGGCTGGGGTGCAGTGGGGTAACTGATCAGAGCTCACTGCAGCTTTGAACTC
AGCCAGCTTCCCTGACTCAAACGATCATCCCGCTTCAGCCTCCCGAGTAGCTGGGACTAC
AGACGGTGCCATCACGCCCAGCTCATTGTTGATTCCCGCCCCCTTGGTAGAGACGGGATT
CCGCTATATTGCCTGGGCTGGTGTCGAACTCATAGAACAAAGGATCCTCCCTCCTGGGCC
TGGGCGTGGGCTCGCAAAACGCTGGGATTCCCGGATTACAGGCGGGCGCACCACACCAGG
AGCAAACACTTCCGGTTTTAAAAATTCAGTTTGTGATTGGCTGTCATTCAGTATTATGCT
AATTAAGCATGCCCGGTTTTAAACCTCTTAAAACAACTTTTAAAATTACCTTTCCACCTA
AAACGTTAAAATTTGTCAAGTGATAATATTCGACAAGCTGTTATTGCCAAACTATTTTCC
TATTTGTTTCCTAATGGCATCGGAACTAGCGAAAGTTTCTCGCCATCAGTTAAAAGTTTG
CGGCAGATGTAGACCTAGCAGAGGTGTGCGAGGAGGCCGTTAAGGCTATACTTTCAGGGA
TCATTTCTATAGTGTGTTACTAGAGAAGTTTCTTTGAACGTGTAGAGCACCGAAAACCCC
GAGGAAGAGAGGTAGCGTTTTCTCCTGAGCGTGAAGCCGGCTTTCTGGCGTTGCTTGGCT
GCAACTGCCGTCAGCCATTGATGATCGTTCTTCTCTCCGTATTGGGGAGTGAGAGGGAGA
GAACGCGGTCTGAGTGGTTTTTCCTTCTTGATGGCTCAATGACAGAGACTAGCTCGTAAA
CTCCGGGCCGTTTCCGGGCTGTTCGCTCCTGCTTGGCAATGTCGCGAGAAAGGTTTTCGC
CTCCTGTTTCAGCGGTGACGGCTCTTGGGTTTTCTCGGGGTGGCTTTTTAATTTTAGTCT
TGGCGCGAGGCGGGGGATGCTGTGTGGCACCTCCTATTGTCTCTTTTTGCGTTTTCTCCC
ATTCTCGCTCCCTCTTTTGTCGCCGTTTCCCGCCCGCCACTCCCACCCCCAGACGGGGTC
TCCGGGTCTCTTGTTCTGTCTGCCGGCCCCGGCTGGAGTGCAGTGGCGCGATCTCGGCTC
CTAGCAACAACTGCCTCCCGGGCTCAAGCGAGTCTCCCGCCTAAGCCCTCCCGAGTAGCC
GGGGCTTAAAGGCGCACACGCCACTCCAGGCTTTTTTTTTTTGGCAGAAACGGGGTGTCA
GCATGTTAGCCAGGCTGGTCTCCAACGCGTGATCTCAGGTGATCCGCCCGCCTCGGCCTC
CCGAAGTTCTGGGATTACAGGCGTGAGCCACTGCACCCGGCCCTTCTATTTTTTTAAATA
GCGACGGGGTTTCACCATGTTGGCCAGGCTGCTCCTGAACACCTGAGTTCAGGTGATCCG
CCCGCCTCGGCCTCCCGAAGTTCTGGGATTACAGGAGTGAGCCACCGCGCCCGACTGAGA
ACTGTAAGAAATAAATTTGTGTTATTTAAGCCACAAAGTCTGTGTATTTTGTTATGGAGC
CCAAGAAAAGCAGCTTCTTCTGAAACTAAACACTTTCGGTATGATCAGAACTCGTGCCTC
TTGGTGTCTACCCAAATGAGTTGAAAATGTCCACACAAAAACCTGCACACCTGTTTATAT
AGCAGCTTTATCCATAATTCCCAAAACTTGGAACTAAGATGTTCCTGAATAGAGCCAGCG
GCTGTGGCTTGTGTCTGTAATCCCTGCTACTTGGGCAGCTGAGGCAGACAGTCAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved