Homo_sapiens Locus Mono:161:AC034186.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:161:AC034186.5
Homo_sapiens
Mono:161:AC034186.5
3
SNORA43L2
1001..1138
2138
TGAATATACTGAAAACCACTGAACTGTATGTACACTTCAGGTGGGTATGAATTATATCT
CAGTATTATATGAATTATATTTCAATAAACTGATTAATACTCAATGTTATAAATCATATC
ACAAAATAAATAAAAATATAATAATCTCAATAGATGTAGAATAAGGAAATGACAATTCAA
CACGCCTTCATAATAATAAACTAGGAAGGGAAGAAATGTCCTCAACCTCATAAAAGGCAT
CTATGAAAACCTATCACACTTAATAGTGAAAGACTAAATGTTTTACCTATAAGTTGGGGT
ATTCCAGAATTAAAAGAACATATATTGATGCAATAGTACTGTCACTCAAATGATTTTTGA
AGGCAATTATTCTTCCTTCTGGGGAGACAGACCCTTGAAAAATCAGATGAAAGTCAGAGA
TCCTTTCTTAAGAAATTCATTTAAAAAAAAGATTGGAGAAAGGAAAGGATGTTTGCCCAC
ACCACTTTTATTCCACATCACACTGGAGGTTCTAACCAATGCAACTAACCAAGGGTAGAA
AGATAAATAAAAGGCATATCGACTGAAAAAAATAAATAAATAAAACTGTTTTTATTGGCA
TGTAACTTGATTGTGTATATAAAAATCCTATGAAATCTATAAAAAAGCAATTAGAAATGA
GTTTCACTAGTTAATAGTATACAAGTAAATATACAAAAATAAATGTCAAAATGACTCTTT
AAAATAGTAATAAACAATGAGAAATAAAAATTTTAAAACTACTCACAATAGCACCAAAAG
ACATGAAATATTTAAGGATACATTTAACAAAATACATGGAACACACACACATAAAAAAGT
AGACAGCACTACTGAGAGAAAGTAAAGGAGGCCTAAAGAGCCATACCACGACTGTGCATT
AAAAGTCTTAATATTGTTAAGATATCATTTCTAAGCTGATCTATGTAATCTCACTCAAAA
TCCCAAAAGGTACACACTAATAAACTGACTGCCCTGCAGATGCTGTCCTGGACCTGCCAG
CTGCACAGATGCAGATGCTCTGCTATGCCTGTAACATCGGGGCGAAGTGAAAGTGGCTAT
TTCTACACTCAGTGTTCAGAAAACACTGAACAACAAGAATGGATAATAGCCTGACATTTC
TTAGGGGAACAACAACAACAAAACTGAGTCTAACATTTATGTGGGATTGCAAAGGACCTA
GAACAATTTTGAGAACACAGTTGAAGGACTTATACTACCTGATAATTTTAAGACTTACTA
TAAAGTTACAGAAATCAAGAGTGTGTCATGAGTGAAAGGACAGATATATAGATCAGTGGA
ACAGAATAGATTCTAGATAGATTCACATGCTATATACATGGCCGTTAGGATTTGACAATG
AGGGCAAAGTAATTCAATGGGGAAAGGATAGTCTTTTTAACAAATGGTGCTGAAAAACTA
GATATACATATTTTTTAAATAAACTTTGACATTTGACATTTACCTTCCACCATACAGAAA
AACTAAATGAAAATGGATCATAGATTTAAATATAAAAGCGAAAATTATAAAACTCCTAGA
AAATAACACAGGAGAAATTTTTTGTGATCTTAGGATAAGCAAATATTTTGTTGACATGCA
ACACAATTGTATACATAAAAAATCATGAAATGATACACAAGAAGCATAAATCATAAAAAA
AGTAAATTAAATTTCGTCAAAATTAAAACTCTCTGCTCTTCAAAGACATCATTAAGAAAA
TGACAAGGTAAGCCACATACAAAGATAAAATATTCACAACACATATATTTTAAAAATTCA
GTATCCAGAATATATAAATAACTTACAAATCAATAAAAAGAGTTAAGGGGCAGAATATTT
CAACCAAGCCTTTATCAAAGAAAATATACAAATAGCAAATAAAACTATCAAAAGACAGCA
GACACCACTAGTCACAGGAAAATGCAAATTAAAACCATCATGAGATACCACTACTACACA
TTGACTAGAATGGCTAAAATTAAGAAGAATGAAAATACCAAGTGTTAGCAAGGGTGTGGC
AAAAGTGGGACTCTCTCACAATGCAAAATGATTCAGTCATTTGAAAAACTGTATGGCAGG
TTCTTATAGTTACATTTACCATATGACCAGCAATTCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved