Homo_sapiens Locus RPL17
snOPY snoRNA Orthological Gene Database
Homo_sapiens RPL17
Homo_sapiens
RPL17
18
SNORD58B, SNORD58A, SNORD58C
1751..1816, 2133..2197, 4172..4235
5992
CACCATGCAACATAAAAGAGGAACCCGGAGGAGAAGACAAAGAGTTCTGTTTAAGGGCA
TGTTAGGTTTCAAATAACCTCAGGTCTTCAGGGACCTCCCAGAAAGGATGTCCAGGGAGT
AGTTTGCTATCAGGGTCTAGCTCAGGAGACAGATGTGGCGCTGGGGTATTAATCTGGGAG
TTAGCATGCAGTTGAAAGCTCATGTGAGGGGAGGGAATTACCGAGGAAACACCATGGAAT
CCAGCATCAGCAATGGAAGTGGAGTCGAGGGGAGAGACTTAGGGCTGAGGTCTCCTACAC
TGAGGTCAAGGAAGCAAGTGAGCCTAGCCTGGAGTCTACTCTCCTAGAGTTTGAGCTGCC
TAGAAGGGTGGTGCCATGAAATAGAAGCCCTAACAAAAGCTAAGTGCATCACTGACTATG
AGGGAATAACCAGAGAGATGACCTGGGGAAGGAAAAAAGGGAAGAAAATGCCAAAAGGTT
TTCTCCTCCAGATGAAGATCTAGAAGCAGCGGGGAAAACGAGGATATTGAACCAGACCCT
TCAGTTAGCGCATTTTTCACACAGGTTATAATACAATTGATTGGATGACATTCCCATCCT
GAGAATTTCCTGATTACCATAATTACGTCTCATCCTTTCATCTTTTTAATTGGCCATTTA
CAAACCACTTTCAGGAGTACAGGGCCACATAATCAAACCTAACTAATGTTGACGAATAAA
TAAAATGTTTCTTTCATATCTAATAATACGTAGCCTGTCCTAGAACTACAACCCTGTTTT
TAATTGACTGACATTTAAAACCCTGAATTTTTATTTCTGTATACAAAAAAGAGAACTTTG
AGACAGTCCCTAAGTAGGCAATTCGTTTTCACACGTTCTTAAAACATATTCTACACTCCC
TTCGCTTTCCGCCTTCCTGCCTCCTCAGATCTCGTTTCTTCGGCTACGAATCTCGCGAGA
AGTCAAGTTCTCATGAGTTCTCCCAAAATCCACCGCTCTTCCTCTTTCCCTAAGCAGCCT
GAGGTGAGTGTTTCTCCTGCGTTGCTCCGAGGGCCCAATCCTCCTGCCATCGCCGCCATC
CTGGCTTCGGGGGCGCCGGCCTCCAGGCCCCCGGGAGGAGAACTCCTAGGGCTACTAAAT
CCTCGCTGGAGGCGGTGGCTTCTTATGCGGGAGGACGTGGCGGAGGGCCTGACTTTGGGA
GCCGGGGTCAGTCGGCCTCTGAGGTCCGCAGAGGGACGTGATGGGCGGGAATGGGGACTA
CCGGGCTCCTCCACTGGTGGGGGCGCCGGCCCGCCGTGGGGTGCGGGCCGCCTGGGGTCC
GTGCGGACTCCGGAGGTCCGGTGTCTAGTGGTGAGTGGTGGCCGCAACGAGGAAAAAGTT
TTGGGGGAAAGAAAAGTCGGGTGGAGGCGTAACACGTTACTACAAGAGTGTTGCGTACAG
GAGGGCTCTTAAAGTGGGTCATAGCCCGAAGGTGTTGAGAGAGACGGCACTCACTACCTG
CAGCCCTGACAGCAAAGGGGTTTCTGTAGAGCGGGAGGGAGGAGGTGTAGAGGGTTACGG
TTGAGTTGTGCCCTGCGGATGCGTCGAGTCATTTTACGCCTGGAAGATCCAGCATTGGAT
TGAAACAGGCTGTATTTTCTTCCAAAGGGTTGACTGGATTGGTGAGGCCCGTGTGGCTAC
TTCTGTGGAAGCAGTGCTGTAGTTACTGGAAGATAAAAGGGAAAGCAAGCCCTTGGTGGG
GGAAAGTATGGCTGCGATGATGGCATTTCTTAGGACACCTTTGGATTAATAATGAAAACA
ACTACTCTCTGAGCAGCTGTTCGAATCATCTGATATTTATACTGAATGAGTTACTGTAAG
TACGTATTGACAGAATTACACTGTACTTTCCTCTAGGTGATCTGTGAAAATGGTTCGCTA
TTCACTTGACCCGGAGAACCCCACGAAATGTAAGTGGACAGGAGGTAGATACCCATTTCC
TACTTGGGGCTTGGCATAAGATACCAAAAATTAACCAAAACGTTTTATTTTCTAGCATGC
AAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGGTATGCGATTCATAGTTGTGATCC
AACAGTTCCTCATGTTCCACTCAAAAAAGGTAGCTGCAGTGATGACTTTCTTAGGACACC
TTTGGATTTACCGTGAAAATTAATAAATTCTGAGCAGCCACCTTATATTTAGGCATTGAT
GATCAGGGTGTAAGGATGTAGCGTTTGTGAAATTGAGAAGTAGTACCAGAAAACCATTTG
AAAACCTAGTGTGCAGATCAAGATGGGGCATTTTAATTGTAATTACATGATGATGGAATT
TAAACGTTTTATAGTGAATAAATGGAGTTTTGGAGTTTTCTCTAGCTTCAACGAAGTTTA
CCTGGCTTTTAGTCACAAGTTTTTTTAATTGCCTTGCCCCCAAAGAATAGAAATAACTCG
ACATTTTGAAAAGCTGAAAATTGAAAATTTAACGTTTACTTTAAAAATTAAAGCTTTGAT
CTAGTTAACCAACACTTTATTCTTCATACTTAGAACACTCGTGAAACTGCTCAGGCCATC
AAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAG
TGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGTGAGAATTCTT
AGTTGCCATTTGAAAAGACAGATTTTAATGGAAAAGTGATGGGATAGGATAAGAATGGCT
AAGATCTGTGCTGATGAACCTATTTCTGGTTGCTGTAATGACAGGACACCTTGGATTGAT
GGTGAAATAAACCATATCCTAAGAAACCGTGATATCAGATAAATTCATCTTGGCTGTAAT
GTTAATTTAAATCAAGGAAAATGACTCATCATCTCCATTTTCTTTCAGGCCAAGCAATGG
GGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAA
AACGCAGAGAGTAATGCTGAACTTAAGGTACCCAAACCACTAACATCCTGTGCAACTTGG
GTGGTTGTTTAATTAATGTTGGCTGTTCAGATTTATGTCCTTGATTTTCTTGTTTTCAGT
AATTAACTCTTAGGATTTTTTAAATTTCTACCTGCAGTTTCCACAGAATGAAACTATTTC
CTTTTATTTTTTTTGAGTCCCTTTATGGCAAAATTCTGTGAAGATCCAGAAGCGTGCTCT
GTGGTCTCTTTAAGCCTAACACTTAGTATTTCTAGTTTTCTGCTGTCTTTTTACACTGGA
GGTACTTTACCAGGGGCTTTTACCCCTTTTTGTGACATACACCTTTGGTAGTATGATTAA
TTATCAAAATGATTGCCTTAGCAGTGATTAATGTGGTTTGTGGCCTACCTTCATAATGGA
GAGTCATGTTGCATTTCAGAAAGAAATTGTTTAAAATTTCAAAAAGTTTAAACAATGACA
AACTTGTGTTGACAAAACACAAATTTCTCCATTTTGTATATTACCCATTAGCCTTTTGCA
TTTGAAGGTCTGGGCCAGAACTGGAATTAGTTTAGGTCTGTATGGCTCCAAACCTTCTAA
GCCATGCTGAGAAATTTTATCATCAAGACTTCGAATTGGGTTCTTCCTTACCCCTCAGCT
CTCCACCCGTCTAAGGATCTTTGGGAAGGCCACTCATAGACAAAATGTATAGCACACTGA
GTTTGGTGGCAATTTAGACATGTAAAGGTGAAGGCAGACAACTGGTTAAAAAAATGCTAT
TTGCAGAATAAAAGGATTGCCTTTTAAAAATGATTTCATTGAGGCAGGACTCTGGAGCAA
GCCTGGGAATTCATATTTAGCAATGATAGTTTGTGGTGTTTTACTAATTAAGGATGTTCC
TGGTTTCATTCTCCTTCCTTTCTTCCCCAGGGTTTAGATGTAGATTCTCTGGTCATTGAG
CATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGG
ATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAG
ATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGGTAAATAAGTAGTTGCTC
GGTTTTGTTTGTGATAGTAGAAAGATTTGTGGTTGCTGTGATGACTATCTTAGGACACCT
TTGGAATAACTATGAAAGAAAACTATTCTGAGCAACCCTTTCACCTGTCTTATTTTGGCT
TTTGTAAGTTTGTTTCTTGACTAATAATAAATGGTAAGTTTTCTGTAATCCCAGCACTTT
GGGAGGCTGAGGTGGGTGGATCACAAGGTCAGGAGATCGAGACCATCCTGGCTAACACAG
TGAAACCCCGTCTCTACTAAAAATGCAAAAAAAAATTAGCTGGGCGTGGTGGCGGGTATC
TGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGCATGAACCCGGGAGGAGGAA
CTAGGAGTGAGCCGAGATCGCGCCACTGCACTCCAGCCTGGGTGACAGAGCGAGACGCTG
TCTCAAAAAAAAAAAAACTGGTAGTTTTATATTCAGTACCTCAGGCCCGTATGATTATCT
GCTGATGGCCCCACTTAGATGTACATAGCCACTTCAAAATGGGCCCTCTCCCCAAATCTA
AGAAGCTTGTTTTCAGTAATTGATCACATTTAGTTCTTTTAAGTCAAGAACCTGAGTGAT
TCTGTACACTTCTTTTTACATCTAATGAACTTAAGTTCTGTTGATTTCTACCATTTAAGT
ATTTTTCCCCCTTAGTCCTTAACGACTAGGTTTCCTGCCTCCAGAATAAGCTGAAGTCCT
CCAAGATGTACTGTGGTTTTCTCTAAGAAACTTAACACATTTTTCTTTCCCCAGATATCC
CAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAA
TGTAATTAAAAGGAAAAGAATGTTGGTTGTCTTTATTAGTGAACATATTTCAAGTGTCCT
TACAAGATGGATCAAATGAGGATTTTTTAGGATTAGAACTAGAAACACAAGATTGTTTAC
CCTGCACCATTAAAAACCATTTTCATGGCTGGGCACAGTGGCTCATTTCTGTAGTCCCAG
CACTTTGGGAGGTGGAGGCTGACTGCTTAAGCCCAGCCAGGGCAACATGTCAGAACCCTG
TCTGTTAAAAAAAAGTAAGTGTGGTGTCACTTGCATGTAGTCCCAGCTAATTGGGGGGCT
GAGGTGGGAGGCTGCAGTGAGCACTACTGCACCCCAGCGTGGGCAAGACAGAACAAGACC
CTGTCTCAAAAAAAGTTTCATTATCCCAAAAGGAATTTGCAGTGGTTTTCTTTGCAGAAC
AATCCAGTATGTGAATATACCAGTTGATCATCCCCAGTTGGAAATGGCTCCATTGAGCAT
TGCCTTTGAGTATGATAACAGCACTCAGGCTCAGGTTTTGAAGCTTTTTAGGTTGATGCT
CAACCTGTATCATTTCGTCAATTGATAAAGGGGTTTTGTTTTTGCTATTAGGAACGATGG
TACTGTGAACGTTTGTGTGCAGATTTTTGTGTTTTCATTTATTGAGTATATACTAGAGTG
GAATTGCTAGATCATAAGGTTACCTGAGTAAACATCTGAGGAACTTCCAAATATTTCCAA
AAAGGCTGCACGCTACATTTCCACCAACGGTTTATGAGGGTCCCAGTTTTCACACAACTT
CGCCAACACGTACTGACATCCTAGCGAGCGTCAGTACTTTTCGTTTATAAAGTGATGTAA
CTGCTTCTTTTAAGCAACTGACGTTTGTAAAGTTGGCCTTAATGTTAGTTTGCTCTGCCC
TTGAATTTAAGAAACCAGCAAAACTAATAGCTTATCCACAGTTGCCTCAACGGCCTAGCT
GCCACCTTCCGTGTGGGTGCCGCGCCGTTTGCACAGGCATCATCCTTTACCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1026, 1896..1948, 2035..2075, 2553..2687, 2928..3026, 3930..4121, 4914..4992
1909..1948, 2035..2075, 2553..2687, 2928..3026, 3930..4121, 4914..4961
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved