Homo_sapiens Locus Mono:100:AL078581.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:100:AL078581.11
Homo_sapiens
Mono:100:AL078581.11
6
SNORA2AL1
1001..1135
2135
TTACTTTAGCTATGTTTGGTATGCATGAGTTAATGAGTGATTAGAGTACTATGAGCAGC
ACAGGTTTAGAAATGCCTATTTGCCTATAGTGCAGCCTCTTACATAGGCAAAATAAAAGT
CAAGTAAGAATTTTATTTTATTTTTTTAAAATGCAAAGTAAAATGTGTCTTTAAAACTCT
CCCAGGAGGTGAAGGGAAGCTACCATAACACCAGGTGGGAAGGAAGACATACTGGGCTTG
GCTCATGCTTTAATTAGCTACTGTGTAAAAATGTTCAGGGATTTTCAGTTATCCGCTGGC
ACCCAGAGGCAATGGGTAAGGTTAACTGGAGCTAGAGCCAATATTTTTTTCTTCCTAGAA
GGAGTAACAGCAGCAAACAGTAGGAGAGAAGATGCCAAGTTAGAAGTGCATATAGCTCTC
TTCCACAGGAGGCCTACATGCCGCCACTTGTGCTGCCGCCATGTCTCTAGTGATCCCTGA
AAAGTCCCAGCATATTTTGCCGAGTAGTCAACACCAACATTGATGGGTGGCGGAAAATGG
CCTTTGCCATCACTGCCGTTAAGGGTGTGGGCCGAAGATATGCTCATGTGGTGTTGAGGA
AAGCAGACACTGACCTCACCAAGAGGGCGGGAGAACTCACTGAGGATGAGGTGGAACATG
TGATCACCATTATGCAGAATCCACACTAGTACAAGATGCCAGCCTGGTTCTTGAACAGAC
AGAAGGATGTAAAGGATGGAAAATATAGCCAGGTCCTAGCCAATGGTCTGGACAACAAGC
TCTGTGAAGACCTGGAGCGACTGAAAAAGATTCGGGCCCGTAGAGGGCTGCGTCACTTCT
GGGGCCTTCGTGTCCGAGGCCAGCACACCAAGACCACAGGCTGCCGTGGCCGCATCGTGG
GTGTGTCTAAGAAGAAGTAAGTCTGTAGGCCTTGTCTGTTAATAAATAGTTTATATACCA
AAAAAAAAAAAAAAAAAAAGTGCATATAAAGTCAGCTTTCCTAGGCCCTGAATCAAGAAA
CGTGATGGTTTGCCATTGTAGCTATTGGTTTCAAACAAGAGCCAAGATTGATGTCTTTCT
TATGGTCTGTTGGCTAATCCCAGTATGAATGGCCAGTTCAGCTAGAAGAAACAAACAGTC
TTGAAAAAAATAGAAAAAGCAAAGAAAAAAAAGACAGCTTTCCAAGCTAAGTAACATTTG
TGGTCAGTGAAATAATAATAGAAATCTAGTAATGCTAAAGTAAAACAAATTTTCAGCTTA
AAAATATTGCCTTTATTCAGAATCATAAGGGTTTTTTTAAAAAAATCTTACCATTATGAA
AGTTAAAAAAAATATAGCACTCAGTACAATGAATTACTGCATTTAATATTCAAACACTTA
AGGCACATTTCTCACAGTTTACATGTGAGAATTTAGCATGATCCAAACTCAAATATCCAT
TTCTCGTATCTTTCAATGTCTGCAGCAGACACTGACTTAGAAACCTTTTTTAAAGCCATC
TCGAAATCCTCCATAGTTGTAGGCATGTGCATTTCTTCTTTGGAAAGATTTCGGATTTCC
TCTGGAGTCAAACCTTCAATGCGCCTTCTCATTGCCATCAAGGACGCATCCCTAGGTTTT
AAGTTAAAAACAACAACAACACACACAATGTTACTTTGGTTAAATGAAAACCTGTTAATA
GAAAAATTTTCAATTGATCTGTTGTAGCATTCTCTAATTATATTACATATATATGTAGTA
TTGTATAGAAACTTATTGGAATACAAAGCCTGTTGTGATTGATTTTTAAGCAGTTAAATC
TTCTGTAATGAAAAAGGATGCTAATTTAAATAATTAATACTGAATATAAAATCCCAGAAA
AAGTAAAAGTGGGGTTAAAGCTAGCAATTTGAATTTCATTATAACTATTCAATAAAATGA
AGAATAAGCATCACAGAGTCAGAAGAGAAGAGAAACTGTTAACAAGAAAATTAAATATTT
TCTCCATGTAGAGGAAAAGCTAGGTAAGTTCAGGGTTTCTCCTTTTCTCATTTGTGTTAA
AAAAAAAAAACAAAACTTCAGATTCAAACAGCTCTTGCCTTTTACCAAGTTTTATCCTTA
ATAGCAGCCACCATTTATGCAAAGGGATAGCAATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved