Homo_sapiens Locus Mono:10:AC024072.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:10:AC024072.5
Homo_sapiens
Mono:10:AC024072.5
10
SNORD55L2
1001..1080
2080
TGAGACCAAATTATAGGATGATAGAATACCTTACCTTTCCCCACATGTTAAAAACACAT
TAATAGGTCTTTTGTGTAATAAAACTGTAATGTAACTATGTCTCAGAACTTATTTAAGAG
GAAATCTCTAGAAAAGCCTCAAAACAATAGGGAGACAAAAACAGTACATCAGAGAAAATT
TTTGCATTTGACATCTACAGCCATAGCAAACAATAAACACAATCTAAGCCCAAGCCATAT
AAACATAAAGCCTCACACTAAATGCCTACTTAGTTCAGTTTATTTTACCCAATACATCAT
ATCTTGCTTTCAAAAAATTACAAGACATACTAAAAGACAAAAAAGACAGTTTGAAGAGAC
TGAGCAAGCATTGAAACAAGACTGAGATGTGGTAGAGGTATTCAAATTCAAATTATTGAA
CCAGTAATTTAAAATAACTATAATTAGGGCCAGGTGCAGTGGCTCATGCCTGTAATTCCA
GCACTTTGGGAGGCCGAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGATCAGCCTGG
CTAACATAGTGAAACCCCGTCTCTACTAAAAATACAAAAAATTAGCTGGGCATGGTGGTG
GGCACCTGTGATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCCAGAGG
GTGGAGACTGCAGTGAGCTGAGATCACGCCATTGCACTTCAGGCTGGCAACAAGAGCGGA
ACTCCATCAAAAAAAAAAAAAAAACTACAATTAATATGCTAGGCATTCTACTGAAAAAAG
CAGACAATACTCATGAATAGATGGGTAATGTAAGCAAAGAGATGGAAACTCAATATTGTT
AAAATATCAGGAAGAATGAAAAAAGAAATACTAGAAATAAAAAACACTTTAACAGAATTA
AAAAATACCTTCAATGGGCTCATTAGTACACTGAACACAGCTGAGAAAAAAAAAATCAGT
GAGCTTGAAGAAGTCAATCAAAACCTCCAAAACTGAAATGCAGTGTATGATGACACCTTG
GTAATGCTGCAGACTCCTCAGTGTGCAGTGAAGAGGTGAACTTTGAAGAGTCACATATGT
GAAAAAAAAATGCATGGAGCAAAAAATGAAAAATACAGAACAGAATATCTAAGAACTGTA
AAACAATTACAAAAGGTGTAACATATATAATAAGAATACCAGAAGATGAAGACAAAGAGA
AAGGGAACCCAATGAGATATTTGAAATAATATTGATTGAGAATTTCTCAAAGTTAACACC
TCCAAACAACAGGCACCAAAAAAAATCAACCCGGCTGGGTGCGGTGTCTCACACCTGTAA
TCCCAGCACTTTGGGAGGTTGAGGCGGGCGGATCACAAGGTCAGGAGATCGAGACCATCT
TGGCTAACACAGTGAAATCCCGTCTCTACTAAAAATACAAAAAATTAGCCGGGCGAGGTG
GCGGGTGCCTGTAGTCCCAGCTACTCGGGAAGCTAAGGCAGGAGAATGGCGTGAATCCCG
GGGGGTGGAGCCTGCAGTGAGCTGAGATGGCGCCACTGCACTCCAGCCTGGGCATCAGAG
CGAGACTCCATCTCAAAAAAAAAAAAAAAGAAAAAATCAACCCTTATGCATATCAGGTTC
AAATCTCAAAAAATCAATGACAAAGAAAACTATGAAAGAAACCAGAGCCGATGGGAAACA
CCTTCCCTGTACAAAAGCAAAGATTAGAACTACATCAGACTTCTCTTCAGAAGCCATGAA
ACAAAAAGAGAGTAGAATGAAAATATTTAATGTGTTGAAGAGTAAAAATAGCCAACCTAG
AAAATTTTTATCTGTGAAATTATGCTTCAAAATTGAGGAAAAATTGAAGACTTCCTCACA
TAAAATTAAGGGAATTTGTTGCCAGTAAACCTACCTTGCAATAAATGTTAAAAGAAGTCC
TTCAGAAAGAAGGAAAATGCAATAGGTTAGAAATTTGAATCACATGATAAATGTGGATCA
TAAATAAATACATTCTATTTTTATTATTCATGATTTACACATATAGCTATTTAAACATAT
AGCTATTTGTTTAAAATAATAAGTAGCAACAATATATTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved