Homo_sapiens Locus Mono:207:AL359641.10
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:207:AL359641.10
Homo_sapiens
Mono:207:AL359641.10
X
SNORA25L8
1001..1128
2128
TTCATCACTCTTGGTAGGGCAGATAACATTGTGTAGCTGTGTACTACTTCCTGTTGTGA
CACAATTCTCCATAGGTATCTGGTGTTTCTGCACATCTAGTGAGCAGAGGTACTGAATGG
CTTTGTTCCAGACTAGCGTTCCAAGGATGTTTGCATAGTTAACAGCCTTAAAAGACTGAG
ACAGTGGCTCCCTCTGGAACAAAGAGAAGATATTACTGCTGATTATAAATTATTTGGGTT
CCCTAAGCTCAAGATTCATCTCCTGTAACTGACCCACTGCGTGTGCAAATATCACTTGGC
CCTCTTTATATTGCCCTGTGGGAATTGGGGCTGAGGAAACTGGTGCAAGGAAATGCTGTA
CTGTGACTACTGCTATTTGATGTGACTAATAAAATCCTTTGCCTCTTATTCAGAAATCTG
TGTTTTTTTAACAGCATTTATGAAATTGTAACAGCTTGCAAGTAGGGCGAGATCTCAAAC
ATATCAGTTCCTGACAACTCCTGAGGGAAGGCTCTACAGGTGCCTATAGTAAGGACCCAT
TTCATCTTTCGAGGCAATAATAATAAGATTAACAACAATATTAATAATAAAATATACTAC
TTGCACACGAACTTAAAAGTTTAAAGAAAAGAAAAAAGATTTTTAAAAGATACTACCATA
TTTTACCATTTATTATATCACTGATTGGTGGTTGTGTTTTTGGCAGTGGTATTTGGATTT
TCTTAGTTGGTAAGGTAATTTTTTTGACTGATTCCACAAGTGATTACACAAGTGAAAAAA
CATTTAATAAAAATTTGTTTACTGAATAGACAAATGTATAAACAGCCTTGACACATTTGT
TGTATTGGTCAACTCAATTAATTGCTGCCAGATGAATGAATGAATGAACATTTGCTGAGT
GTCTAGCATTCATGTAGGTACTCTTCTACTTTGTCCTATCAAGTTCTCCACTTACCCAAG
CAACCCACTTTACAGGTAGATTATTTAAAATAAGGGGACCCAGGTCATTGCAAAGAGGGC
TTGTGGGGCTGTGAAACCGGGGGCTTTTAACGTACTGACCAAAGACGGATGTTCTCCATG
AGAAGCTATAGTCACAATCATGACACAATTGATGACTGGTGATGTGGGAAGGTAAATAAG
TGTTTCGAAATTTAAAAAAAAAAAAAAAAAGGAGACCTGATCCAAACTAACATCATGAAT
GATAACTCAAGTGTTTATCATTTATATCTTGGTATGATGTGAATAAGAAAGGGCATATTA
CTTCTGTGGCATTCTTCCCAAACATCCGTAACTCCAGTCTGATCATGAGAAATCATCAGC
CAAACCCAGATTGACTGAAATTTTCCAAAATATTGTGTTCAGTGTTCTTCAAAGTGTCAA
AGTCATGAAAAACAAGGAAAGACTGGTAAAAAAAAAAAAAAAAATGCCACAGGTTGGAGG
AAACTAAGCAGACATGATGACAAAATAAAACATGAAATCCTGAATCGTATCCTGAACAGA
AAAAGGACATTTGTGGGGAGACTGGTGAAATCTGAACACAGTCTGCAGTTTGGTTAATAA
TAATGTATCAATGTTAATTTCTTAGTTTTGATAAATCTGCCATGGTTATGTAAGATGTCA
ATGAGAGGAGAAGCTGGGTGAAGGTTACACAAGAACTTTCTCTATTTTTCCCACTCTTCT
GTAAGCTTAAAAGTATTTCAAAATATAAAGTTAAAATATGGAAGGAAAAAGGTTAAAAGG
GAAGAGAGAACAGCAGTTAGCAGGGCTATCATGTTTCTAGTTGACAAAGTTCTTCCAAAA
CAACCTTATATCGGCTGCTAGGCCTGCTAAACTTTCTTTTCCCAGCTCTGTAACTGTCTT
CATCATGCTTCCTTCTGCAGTTTTAGTCAGAAACAAAATCAATTGAAAAGCAGACAACAA
AGTGCAATCCCAACAACCTCTCATCCCCTGAACCCACTCCTGATGATTATCAAGTTGCTC
CACATTCTCCAGCCTTTGAGTACATACTGGCTTTCTGAGTTCTGAGAAGCATTAGATCTT
CCTAAGAATTCTAATGGCAGTTAAAAAAAAAAAAAAAGGCATATCATAGACTCTCCCCCA
GTGAAGTGTATTTTGCTGTATTTAAGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved