Homo_sapiens Locus Mono:111:AC096743.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:111:AC096743.3
Homo_sapiens
Mono:111:AC096743.3
4
SNORD50AL1
1001..1071
2071
AGGTGTGGATCTAAGCCATTTAAGTGTTTAAAATCTCAAAAAGTGATTTTTGATATGGG
TACACTACCTTCATGTGCAGAAAATAGGTGTACTCTAGGAATAAAGGAGTGAGATGGTTG
AAAGATAGGAGCTTAAAAGAAAAACAAACTTCTTCGCCAGTAGCACTCCCACAAGCATGG
TGAATGTTCCCAAACACCCATCAGACTTTCTATAAAAAGTGTGGCAAGCACCAACTCCAC
AAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTGTATGCCCAGAGAAAGCAGCATGAT
GACAGGAAGCAGAGTGGCTATGGTAGGCAGACTAAGTCAATTTTCTGGAAAAAGACTAAA
ACGATCAAGATTGTGCTGAGGCCTTGAGTGCATTGAACCCAGCTGCAGATCTAAGAGAAC
GCTGGCAACTAAGAGAAGCAAGCCCTTGAACTGGCTTGAGATATGAAGAGAAACGGCCAA
GCAATCCAGTTATCAGTGTCATCTTTTGTTTTATTATGAAGACAATAAAATCTTGAGTTT
ATGTTAAAAAATAAAAGACAGGAGGTTGAATTTCAGAAGTCTATCAGTTCTTGGTAATAA
GATCCAAAATAAGGGAGTGGGTAACTAGAGTAAAGGTTAAAATAATAAGAATTTAAGAGG
TCAAAAAGCTGTAAGTCTAAGATCTCAGATGGGTCACCTATGAGGACAGTATTACAGGAT
GACGATGCACCTAAGCAGGGAGGGACAACCCGTGATCTAAGTGCCAGTGCCAATAATGAG
TATGAGGATGTGGCTATGTAGGAAGTGAGCAAGTGGAGGTGGGCAGGGGAGATGGGTGTG
GTAAGGTGGAGATGACAATGGCATTTTAGGATATATGAGCATAGTGAGAAGCAGAAATGT
TTATACAATAATGGTGCTGAAAGAAACGTTTTTAAGCAGACCAGTAAAACAACAGATCAG
TAACTGAGAATAACCTCTGCATGCACTAAAAGAATGAGTTACATCTGTGATTATCCTATT
CTGAACCTGAATTTCTACTAGAAAAAACTTATATGAATCTGGCTTCTGAGATAGACCATT
AAATTGAAAAGAAAAAAAGAATGAGGAGAGAGGGGCAAGGAAGGGAAAGTGCAGGTCATT
TGCCTGATTGCCCTTGAATGCATTCTCTGTCCTTCCCCTTCTCTGTTGAGTGTTGTAGGT
TCCCTTTCTAGTTCTCTTCCACATAGGTTTGCAATGGGAAGAGCTCGCAGAAGAGCTGGA
GGCAGCAGAAGAGGGGAAGCCAAGGTCATGGTCCTCTCACTGTCTCAGATGAGGATCTGG
TAGTTGGTGGTGGCTTCAGCTCCTTCCAGGCAGCCCTCTCCGTGGTTCTACCTCTAGCTT
CCATGCCCTTGCAACAGCTGCTTTTCTCATTGTCCTTCTAGCCAAAGGCATGGTTGGTAG
CAGCTTCTTGCAGTTGGTAATTTCTGTGTTGTTTCATCCCTTTAGGCTTTGCAGCTCTTT
CAACACCTATGTAACCATTCCTTGTATTAAATTCCAACTATTTATTCCATCTGTGTCTGT
TTTCCTGACATAGGAATCACCTTTGATTGAAATAATTTGGATCAGAGGTGATGGGGGCCT
GAACCAGAACACCAGTAATGGAAATGGAGAGGGAAAAAATGGATTCAAGAGACATTTCAA
AGGTAAAATCAGCAGGGCCTCAGTACCTGACTGGATGTAGCAGCAGGTGAGGAAAAAGAA
TGAAATGATACAAAATTCTGACTTAGGGCAGACCAAGGAAGGCAGGCTAGGAAGACACAG
GAGGAAGAGAAGGCATTAGGGAGGCATGGGGCATGTTGAGGCTGAAGTACTTCAATGTAG
AAACATTTTTAAAACAAAAAATTCCTTAAAAGACAAAGGAATCTCTTCTTCAAAAAGTAG
AATTATAAACAATATGGTAGACATTCATGATCATGGTCTGTAACCCACATGGTTAAAAAT
AAAACATACTAGAAACAGCAGCTTGAATGAATATCATGGTTAATTCTATTTTTTCCCCAT
TTTGTTTTATAAACAGCACATACCTCCATTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved