Homo_sapiens Locus Mono:66:AC018563.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:66:AC018563.7
Homo_sapiens
Mono:66:AC018563.7
15
2219
GGTTGAGTATTCACTTCCCCAGCTTTCTCACTGCAGGATTACATCAGACTGGCTGATTC
CTTAATCAAAGGTCTCAGTTCTTGTCAGGTCACTCTACACATAGCCTTCTCTGACTCTAG
GTCCCAGTAACTACTCCTTTCTCTCATTCCCCCAGCACTTTTGGTGGAAATGAAGCCTGC
CATTATGAGCTCTGGGTTACTTTACTTTTAGTGTTCCCATACCCAGACTGTACTTTTGTA
AGTGTTTTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTTTACAAAT
GATGCCATGTATTTCCTTCTGGGGTTTCAACTGACAAAAAAAAAAAAAAAATCCAAATAC
ATCACTAATTATACTAAACTCTCCAGTTAAAAGTTTAACTTTTAAAATGGACAGATTGAA
AATAGACAGATTTTTTAATGGAAGATTGTATTTTAAAACTATAATAAAATCAAAGTATAT
GTTGCTTACAAGTGGTGTACTTAAAACACAAGGGCACAGAAATGTTGTGAGTATAAGACG
AAAAAGCATCCCATGCAAATATTACTACTAGCCAAAATAAAGTGAATATATTTGTAGTCA
CACCAGGCATCAAGCATTATTGGAAATAAGAAAGAAACCAAACAAGGCCGGGCATGGTGG
CTCACACCTGTAATCCCTGCATTTTTGGAGGCTGAGGCAGGAGGATCACTTGAGGCCAGG
AATTGAAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACCAAAAATACAAAAAAA
TTAGCCAGGTGTGGTGGCGGGTGCCTGTAATCCCCGCTAATCGGGAGGCTGAGGCTGAAG
GATCTCTGGAACCTGGGAGGTGGAAGTTGCAGTAAGTGGGGATTGCGCCACTGTACTCCA
GCCCAGGTACAGAGAAAGGAAAGGAGAGGAGAGGAGAGGAGAAAAAAGGGGAGGGGATGG
GAGGGGAGGGGAGGGACAAATAATGATAAAAAGAAAAATTCAAGACGATACTTTCAAGAA
TCATGATCATTCTATACAGTTCATTACTAGAAAAGTTTCTCTAAACATGTAGAGCGCTGG
AAGCCATGAGGAGGAGTCTCAGTGTTGTTGCCTGAGCATGAAGCAGACTCTTGTTGCTTC
ACTGCAACCACCATGTACCATTGATGATGGTTCTTCTCTTCCTCCAGGAGAGTAAGAGGG
AAAGAATTCAGTCTGAGTGGTTTCCCTTCTTGTTAAAAAAGAAAAAAAAATTCACCAGGA
AGTTATAACTATTTAAAACACGTATGTATTTAATAAATAGCTTCAAAGTATATAAAGTAA
AAAATTGACAGAATTACAAAAAGAAATTGAAAAAGCCATAAACATGATAGAAGATTTTAA
CACACTTTTCTCAGTAATTCAGGAAAATAAAAATTAGGTAAAATGTAGAAGATGTGAACA
ACCCAATAATTAGAGTATATGCTTTACAAACACACAATTGTAACCAAAAAAAGTGTCACA
AAGCAAACTTCTATACATATCAAAATATAAGCATCAAAAAACTCAAAAACAAAAACAAAA
AAGACCCACGTTCTCTGATTATTAGTTTGAACTTGATAACAATAACAAAATCCTATACAT
GAAGAAACACTTCAAAAAAATGAATATTCAAATAAATACTAAGAGTACAGAAAGGTACAC
AACATCATTCCAAATCAGGGAAATGCAAATTAAAACCAAAGTAATATCTTAATACTAGTA
CATACCCCCAAGAATGACTAACATTAAAAAGAGTGACATTACAAGGGTGGGCAAGGTTGT
GGAAGAATTCTTCCCCTCATGTATTGCTGGCATGAGTGTAATTGATACAATGATTTTGGA
AAACTGTTTGGCAAGACCATAGTTCCCTACCCATGGTTTTGTTTTCCACAGTTTCAGCTA
TCTATAGTCAGCCACAGTTTGAAAATGTTAAGATATTTTGACAGAGACAGAGAGAGGCCA
TATTTACATAACTTTTATTACAGTATATTGTTATAATTGTTCTACTATTAGGTATTGTTG
TTAATATCTTACTATGCCTAATTTATAAATTAAACTTTTTCATAGGACTGTATGGGAAGA
AACATAGCGTATATAGAGTTCAGTACTATCTGAGGTTCCAGGTATCTATTGGGGGTCTTG
GAACATGTTCTCTATGGATAAAGGGGGACCAGTGTATTATTAAAGCTACATACATGCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved