Homo_sapiens Locus Mono:135:AC134043.1
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:135:AC134043.1
Homo_sapiens
Mono:135:AC134043.1
5
SNORA68L2
1001..1126
2126
GGTGTGGTATAACTGTCTGCTTCATCTGCCCATTTTAATTCTAGGAGGATCTGTAATTG
AAAATAAAAGAGTGAATTATGAAAACTGATTAAGCCAAACCCATCGTATTCATATATTCA
TGGTAAGTTGAGAAACACCTTGTGCACTTGCTATTTAGAATACGTGTAATTATTTGGAGA
ATTTATTAATAGCAGATGAGCGAATCAAACAGAATTGCTTTATAATTTAATGTATAATAT
TTAATTGAATAATTGATTAACTTCTGACTTTAAGTTCAATGTATAAGAAAACTTTACTAA
ATTTAAAGATACTATTGGAACATTCAGAAGAACCTAATATTCACCATATTTATGTTTCAT
ATGTTAGAGTTACTTAAATTATTTTTGTTACACAGTTGAATGACTTAAAATGAAAACAAG
TACATTAAATGTATGAATGTAATTTTTTGATGTTTAAGAATTAAAATTGTCCAGCGTGGT
GGCTCACACCTGTAATCCCAGTACTTTGGAAGGCCAGGGCGGGCGGATCACCAAGTCAAG
AGTTCGAGACCAGCCTGGCCAATATGGTGAAACCCCATCTCTACTACAAATACAAAAATT
AGCTGGGTGGTGGTGCGTGCCTGTAGTCGCAGCTACTTGGGTGGCTGAGGCAGAAGAATC
GTTTGAACCCAGGAGGCGGAGGTTGCAGTTGCAGTGAGCCGAGATCGTGCCACTGCGCTC
CAGCCTGGGCAAAAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAAGAATTAAA
ATTAAGTTTGTAAATGGGCTCACACATTAATCAAAGGCCCCCTTAAAAGTGACTGTTAAA
GTCTTATTTATTCATTAATAGAACAATGTGATTTTTATTTTGAATTTTAAAGCTTAAGGA
CAAATAGTCTTTTGATCTTATAACCTTAAATGGAATATTAATTTCTAAAAACCAAACTCA
TCATAAATAATCTTTTCTGGTCATAAAAACTGCCATCACTCATACCTAAACCCAAGAATC
ACTTTCTTATAGTGATGATTTAAACAGATGCAAACAGCGAGCACATCTTGTCACCTTTGC
GGGACTGTGGCTGTGCCCCTCGCAGTAAATTTGGAGGTTCTACATCCCTGGTGAAAAACA
AAACAAAACAAAAAAAAAGCCTGCCATCATTGACACCAAAACACTCATAATGACAGTACC
CACTGTAATGCTTAGAAGTGAAAAAATAACATGCCATGAAAGAGACTAATTGAAGGGGCT
TAATTTAGATCAGGGGTTCAAAGATCTCTCTGGAAAGTGCCTTGTGAGCAGAGACTTCAG
AAAGAAAGTTTAACCAAAGGAAAATCAAAAAGAAGAGTGGTCCAGGTGGGATCCTAGAGA
GAGCTTAGTATGACAGAGGAATTGAAGGAAGTTGGGAAGTTCAGAGAAGCTGGAACCAAG
TAAGTCAGAGGGAGAGTGGCATGGATGGGACAGGAGAGGAAGCTGCAGTCAGATCATGCA
GGCCTTTGGAGACCGGGTTAAACCATATGTTATATAAACACAAATATACAAATCCCTAAA
TGTAATGGAAAACCTCTGAGGATTTTAAGCAGAGGTCGGGGTGCTGAGTATGGTTGAATA
GCCTGCGTACTGCACAACTCCATGTTGCACCAGTGGCATAGTTCCTGGTGTGATGCAATA
TTGCCTCTGGGCAGGTAACACAATCAAATTAGTGTTAAACAATTACTCTGGTTGCTGTAG
GGAGAAGAACTGTAGAGGTAAGAGTGGAACCAAGGAGATCATTTAACTAGCTAATGCAGA
CTCCAATCAAGTAGCCTAACACAGTATTTGTGGTGATAGGGAAAAGTGGACAGACTGTTT
TTTTTTTTCTATTTCCATGGCAGACAGTAGAAGTCTGGGTAGATTTCTGAATCTGAAAAT
AACCTATCTTAAATGGTGCTTGAGAAAAATTAATCGTCCATCCAGAAATGTGCTAGAGCT
GATATACAGCAGCTTGTATTGGTTCAGTAGAGACAATGGGGTCCACCTTTCCCCAACTCC
TCATTCAGTGACATCAAGTTGATAGCTTGAAATCTGCCTTGGTGGGAGTATTTATACCAT
GGAGATTAGCAAACACTACCAATAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved