Homo_sapiens Locus Mono:70:AC026992.12
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:70:AC026992.12
Homo_sapiens
Mono:70:AC026992.12
15
SNORA77
1001..1128
2128
CATAAAAACCCCGCTCCCAGTTTCTTTTGATAAATCTGAAGATCTAACAGCCCTGGGCT
GAATCTGCACATGGAAAGAACGGGATGCAGCCCAGGAAACACAGCTTCTTCACATGGATA
CTCACCCTTAGGTTTGCTGAGGCCTCACTACTCCTGCCAGGCTTGGCTGGGAGCTTTGGG
GAGTTTGGAGCCCTGGTGATAAAAGTCAGGTGTCTGATCACAGAGAAACAGGCAAATTTG
GCTGGCGTCTTTGGAGCACCATTTCCCAGGCACTGGAAAATGACGACATCAATGGGAAAT
GATGAAGAAAGTGAGGAAAACCAGGACAGTTTTCAGACAAGTTGAGTTTGATTTGCATGT
ATTTGCAGTTAAAAAAAAATGTGACTGCATCTTGGAGGAGAAGTTGAGGCTACAGATACA
TTTCAGAGGGAGAGAAAAGTGGCTTTCAAAGCCCCAGGGAATACCTGAGGTCCCACCAAG
GAGAGGAACACAGACAGGGGAGCCCAAGGGAGAAGAAAAAGCCAGGTTCATGGGATGATG
TGGTAGAGGTGATGATAAGCGTTCACCCAGAACCTTAGTTTCCCGGGCAGATGGCTGTGC
GTAGAAACTGCGGTGGGTGGAGAGGTAGATGAGGCTTAAGGAGACAGGAGGGGTCACGTG
TTTGGGGAGTGGTCAGGAACCAGCCAGGTGAGAGGCAGCGAACTTGGTAGGCTGCTTGGG
TTAATGTAGTTCCGAGTTTGCACCTGCCCTGGGGCTGGTAGCAGAAGTGGAGAGTGGGCA
GGAATATGCTTGATCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCAGCAC
ACATTTCCTGAATACCTACTATATGTCCAAAGCTATGGTAGGAAAGATATGGGGATGAAG
AAGCAGACACAACAGTTCTATCCCTTAAGAGCTCACATTCTAGTGTAGATCTGCACTAAC
AATTGCCACGCGGCACATCTAATAGTAAAGCAGTGGTTATTGCAGACTCACTGTGCACCT
GGCTGCAGGCCCAGGTGGGTGCTCGTTCCCTCTGCAAGAGAAACAAACATTCCAGGGTGC
TGTGGCTGCCTGACCTATAAGGGCGATGCAGCTGCCTGGGGATAGACAGTGCTTAAAAAA
TAGTGGTTATGCCTCTAGGGGAACACAGAGGAGGGCATTATGCTAGGGAGTCAGGGGAGA
CTTCTTGAAGAAATGAAGCTTGGGGCCAGGCGCGGTGGCTCACGCCTGTAAGCCCAGCAC
ACTGGGAGGCTGAGCTGGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAA
CATGGCAAAACCCTGTCTCTACTAAAAATACAAAAATTAGCCGGGCATGGTGGCGGGCAC
CTGCAGTCCCAGCTATTTGGGAGGCTGAAGCAGGAGAATCACTTGAGCCTGGGAGGAAGA
GATTGTAATGTGCTGAGATTGCCCCACTGCACTCCAGCCTGGGCAACAGAGCAAGACTCT
ACCTCAGAAAAAAAAAAAAAAAAGAAATGAAACTTGGGATAAGTCTTGAAGAGTCAATAG
GAGTGCCACAGCTATGGGGGAGAGCTGAGGGTATAGCAGGACAGGGCCATGGAGGTAGGA
AGAGGGCGTGCCATTCGAGGACCTATCTGTAGTTCAGCACGGAAGTACGCAGGGTATGGA
GTGGCAGGAGGCCAGAGTGGAGCCCAGAAAACAGAGGCCAGATGAAGAATTGGTGTGCGC
TGCATATGAATGGGGTGGGAATGAATGCTCTAGTGGGACTGGGAAAAGAGAACCTGAGCC
TCAGGGATGGTGATGAGACAGAGGCTGGCCACTCCAATTGTGGTGGCAAGGAGAATGCTG
AAGAGTGAATGCAGCCTAATTTCAAACCCTGGCTCCATCATTTACTGTGTGCCCTTGGAC
AGATTCCTTAGTTTCTGAGTTTCTAATCACTTGAATGAGGATCATAAAAGTTTCAACGGC
TCTGGTGAGGATGAAAACCCATGGTATCTACCAGATGACAAGGACTCAATAAAGAGCTAT
TATCACCACTGCATTTTAAGCTGTCTCAGGTCTGCATTAATGCTCTCTCCTGTGCCTTCT
GCCCTTGGTTTATAAAACTGCTTGAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved