Homo_sapiens Locus Mono:104:AC093777.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:104:AC093777.4
Homo_sapiens
Mono:104:AC093777.4
4
SNORA63.10-201
1001..1123
2123
ATTACTGTTATAAGCCCAGAATAAATTAGAGAGACCCACAAATTGTGGATTTAAAAAAG
TATTTATAGAATGAATAAATAAATGGACAGATACTCATCAATTGGCTGAACCACTCACTA
TTTTAGGTGGTTGGTACAAGTGAGTGAAGGTCAGGAGCTCTTGACTAGAGTAGCAGCAAT
TTTACTTAGATTTACATTTATTATTGAACATGGGTCATACTCTCTAATATCTGTGCTAAA
TAGTAGCTGTTGTTGAATATTAATAATCTCTATTATCACTGTGAAGTCTGCAATAGGCTT
TAAAATAATGCACACAGACATATAAATCTATGAATATATTTCTCACTTTCCTTCAAAGGG
GCCCATTGTAATTTGCGTACTCTACATCAGGATTCTTTTTGTCCAGTGTTCCTCAGCTTT
AAACCAACTTCTTAGTTTCCTGATCATTTAATGTTATTTCCTCTATCAGCAACATTGCAA
CTTTCCATCAGCTTTTCTCTCTTCAGAAGGCCTTCCTCTTACTAATTTTATCAGGTTTTT
CTCCACTTCCAGATTTTATCCAACTGAAACATCTTCACTTCTCTATAGAGCTCCTTGAAA
TTGACATCTTTTTTTTTCAATTTGCCTTCTAGTCTAGCATAGTATTCAGAGCAGATAAGA
ATCTCAGGAAAATAAATGAATTAAATAAAATAATGAATGGATAGATATATGAAAAGACAG
ATGGTTGGGTAAAACAATAAATGAATGAAATGAATGAGTAAAATGAATGGATCTATCCCT
CATAAATCTAAGTTTTGTGGAAGACGAGGGCACATACATCTGGCCTTATCTCACAATGTA
CAAGTAACCCAATAACAAGAATCACAATAGGCTAAAGAACTTCTCATAAGTCCACATGAG
GGGTCTTCGTTCCACACTGACATATATTGCTTCTGCTTGAGAACATCAACAGCAAATACC
ATTGAGGAAATACAGCCTTCTCTCATAAAAATCTCATATAAAGGCAGGTACTGTTAGAAT
ATAACTGAAGTGTTTTATTGTTATTGTCATTGCTTAAAGCATTGGATACATAACTATCTC
TAACTCCATTCCATACTAAGACAGAGATGTTGCATCTCAAACATCTTTTCCTTGGGAAAA
AAATAATCCAATAAAACCTCATACTTCTCCAAAACACAATGCTCTGGAAGCTTTGTCTAA
TAGAAGTTGTCCATTAGTGGACATCTGATATGGTTTGGCTGTGTCCCAACCCAAATCTCA
TCTTGAATTAGTTCCCATGATCCCCACATGTCATGGGAGGGACCTGGTAGGAGGTAATTG
AATCATGGAGGCAGTTGCCCTCATGCTGTTCTCATGATAGTGAGTGAGTTCTCATGAGAT
CTGATGGTTTTATAAAGGACTTTTCCCCCTATTGCTCAGCACTTCTCCTTCCTACCATCA
TGTGAAGAAGGATTTATTGCCTTCCCCTTCTACCATGATTGTAGGTTTCCTGAGGCCTCC
CCAGCCCTGTGGAATTTTGAGTCAATTAAACTTCTTTATGTTTTAAATAAATTACCCAGT
CTCAGATATTTCTTCATAGCAGCATGAGAACAGGCTAATACAGAAAATTGGTACCACAGA
GAGTGGGGTGCTGCAATAAGAATACCCGAAAATGTGGAAGCAACTTTGGAACTGGGAAAC
AGGCAGAGGTTTTAACAGTTTGGAGGTCTCAGAAGATGACAGGAAAATGTGGGAAAGTTT
GAAACTTCCTAGAGACTTGGGGGGCTTAGAAGAAAGGAAGATGTGGGAAAGTTTGTAACT
TCCTAGAGACTTGTGGAATGGTTTGACCAAAATGTTGATAGCGATATGGACAATGAAGTC
CAGGCAAAGGTGGTCTCAGATGAAGATGAGGACCTTGTTGGGAACTGGAGCAAAGTTGAC
TCTTCTTAATTCTTTAGCAAAGGGACTGGAAGCTTTTTGTCTCTGCCTTAGAAATCTGTG
GAACTTTGAACTTGAGGGAGATGATTTAGGGTGTCTTGTAGAAGAAATTTGCAAGCAACA
AAGCATTCAAGAGATGACAGAGCATAAAAGTTTGGAAAATTTGCAGCCTGACAATGTAGT
AGGAAAAAAACACATTTTCTGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved