Homo_sapiens Locus Mono:121:AC016651.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:121:AC016651.8
Homo_sapiens
Mono:121:AC016651.8
5
SNORD118L3
1001..1135
2135
CTTTAAAGAAGTCTGTTTACCCGATCTTTTTTGAAACCATCAGCCTATCTGAGAAGGCC
AACAGTCGCCCATTATGGAGAATTAACACAAAATTTATCAGCAGAAGTTATTTTTCATGA
ATATTATAACTTCCAATTATGCTAAAAGCTTGTCTATTTTAACTCACTTTGATGTTAGCT
GTGAAGTTCCATGTTTCCCTGTCAACTAATCAGCATTGTTACAATCAGGACAATGTGGGT
CTATCCCTCAGGGTTTGGTGACCAAAGTCACTGTTTTTAAAGGGAGTGTTGCCCTCAGAA
AGAAGAATAAAAACAAATTCTTAATAAACAATGATGCTATTTTCATGTAAATATCTGTAA
GGAAAATGGGCATCAAAGCTAAAGGGGAGATGACATGCAATGAATTTGTTCTGCATAATT
AAGGTATTGGGTAAGCACAAGGAAGGTGAAGTCTCTGGATCTGAGCATTTTATTCTCGGC
TCAATATTCCTTTCATGTGATGCTCTTGGATGAGCAACTTCTGTCTCTCTTTCCCCCTCA
GGAAAGCCATAAATATAATCAACATTACCTTAAACTTCACCTTGTTCCTGAAGTAATATG
AGACCTTGGTTGAGGAGGATACAAGGCATTGTGAAGGTGAACAAACCAAAAAGCATTTAA
AATTGCTTCCTTTTGCACATAGAAATTTTTCTCTTCTCTGGCCAACCCCTCCCAATTTGA
GAAAAAGCTAAATTAACTTTTTTAACTTACAAGAATGAAAAAGTACTACAATGGGATGTG
GGTATTACTTGGAGAGGTACAGTATAGGAATACATTATTTGATACCCAATAGCGAACACA
TTAGCCGTTCCCATTTGCAAGAATCTGAAATCTATGATTCGAGATCCTGGTTCTAGCATC
TCTGACTTTCCCTGCCCCTACGTGGTTATTCTTACATTACTAACCTCACAATTAAGTACT
GAATGTGTTGACATCATATTTCTGTACAGAATGTTATTTCATCATCAGGTGGGATCATCC
TTACCTGTTTCTCCTTTTGGAGGGCAGATCAGAACATGATGATTGGAGAAGAATGAAACG
TGATTAATAACTCTGTGTAATCAGGCCTTGCAGCACCCCAATTGAGCCTTTCTGATTCTT
CCTGATAATCTATTTTTAAAAAAGAAAAAAAAGAAGAATATCTCCCTTTGAGTTGTAGGT
AGGAAGGTAGACGAGAAGTCTGAGAAGTATCAATTCATTGTCCTGATAATTACCATTGAC
CTCTAGCTTCCATCAAAACCATTTCAGAACTCAGGGACATTTTCAGGATTCAGGGAGAAT
CCAAGTTGAATTGAGTTTGTTTCTGTATCACTGACCAGCAATGATGTTGAAATGATTGAT
ACAGTCTATTCCGCAGATAAAGACCTTGTTATGCTACTAAAGGTGACTGCTACCTTCAGG
CAAAGGGCTTGGTGACAGAGTCAGGCAGATCTGGGTGATAAGCTTCACCCTAACCAAGTA
CTGGTTGTGTGAAACCATGGATGATTGCTCTGTCTCACTGAGCTGAAAAATATCTAGCTC
CTAGGACATAGTTAAGCTTCACACCACTGGAACAGTCATGGCTGTCAATGGACATTCAAT
CAACTTAACTTTTCTTCCTACTAGAATCAGTCCCGTGGAGGCCCTTCTAGTGTCATGTAT
CAACATACCCCAGTTCTGTGGGTTTAAGTTTCAATGACAGGGAACTCATCCAGGGTTTCT
TTGAACTGTTCTTCTTAGACTATTAGTTCTACATGCTTGGTAAACTACAGCTCTTTCTCA
GCTCTTTACACAATAACTACATTAATATCATGGCACTTTCTATTTTTTCACATGGCTGCT
TCAAAAAAGGTATAAAAACTATTGGTGTCAAATTTACTTAAATTATTAGGTTTGTCAGTT
GAGAAAAAGGATGAGACAAGTCTCAATCATTTTAGGAGCTTTCTTTGCCCAAGTTAAGGA
CACGTGCCTGGGAGACAGGTCTATATGTTTCTCCGAAGATGATTTTGAGGGCTCCAAATT
TAAAGGCGAAAGGGTGAAATATTGAGAAGTGCACAATTTTCATGTAAGAGGAGGGTAGGA
AAAAAATAGTCATTCATGCTTTATCTGGCTCAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved