Homo_sapiens Locus Mono:47:AC012501.7
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:47:AC012501.7
Homo_sapiens
Mono:47:AC012501.7
2
SNORD56L7
1001..1071
2071
ATTTGATCACAATGAATGATCCAAGACCTCATAATATATATCAAGAGCCTTTAAAAGTC
CATTTTTTAAATCAATTTATTTCATTTTTGAGAATCCAAGGAAATAAAAAAATCAGGAAA
AGTTTTACATAAAGCTGCTAGTTAGGTCATAATTTATATTACAAATTAGAAACAATCTAA
CTTTTTGACAGTAAGAGAATGCTTGAATAAGCTATGAAACAGAGCTAGAATTTGCTATTA
TATAACCAATAAAACTATAATTATGAAGAGAATTTATTATATGGTAAGGCATATGCATAG
GCTACTACCAGAGTAATACTACAGGAAAGACAGGAGAAAGATGTAGCAAATGTTAATAGG
CTGTAAATGTAATAAATAATCGTGGTTACCTTTCAGTTTTAGGATTATACGTGTATTTTT
CCCCTTCTTTGTAGTGCATATTTTCCACATTGATCATCAGAAAAAAGACAAGCCACATGA
AATAATCAGTGCTCCTATCTGACACCTTGCATCTTGTTGTTTCGTGTCCCTCAGTCCTGC
CTTGGTCTAGCAGTTTTGGAGGCCAGAGCTATGAGAGCTTAGCTATGGATTTGGCCAGCT
GCCCACTGTTCCCCAGTGCTATCCTGGCCTCTTCACCTACATTTACAATTATTACAATAT
TTGTTGAGAACCTGTTATGTGCCAAGCATCAGTTTAGGTGCAATAATAAACTTAGAGATG
TATGCCATTTTATGTTTACGCTTGCAGTTAGGTTTATTTTATTAGGGCGACAAGACTTAT
TTACTTGAAATAAAAATCAGGAAACAAAAGAGCACTTAATCTGAAGCCAAGATATTCTAT
AGGCCAGTAGCTTTTAAACCTTTCAATGTAAAGAATATGTGTGTCTATGTATATTTGGAA
ATAATGTCTCACGGAATATTCGTCATCACTATGTTTAATAAACTCTGATATTTTCTATTT
ATCCCCATATTCCTATTCTGCATTATTACATTTAAAATACACTATTAGGATGACAATATT
TTTTGTCAGCAGCAGCTTACCTAATGAGTGTTGATGCTTTGGGTCTGAGTGAAGAAAAGA
TAAAAGAAGAAAAAATATGCTAATCACAATCCACTAGATTGATTCCATGACCTATTACTG
GGTTCGAATCCAGAGTTTGAAAAATACACCTATAGGCAAAAAATTCTGAAAAATGCTTTA
AAAAATCAATGTAGTCCCTGTAAATTACTGGGAAAATCTGAGTTTGAAAGTAGTATTCAA
AATAGTGACGGTATCCATGTGGGAAAGATAAACCAACAGAATTAATCTGATAGATTCGCC
TGAAGTTCAGAGCTGCTGCTTCCAAATAAGTAGAAGTATACTTCAGTAGTTAAGAGTGTA
GTCTTTACAGTTAGACCGACATGGGTTCAAGTCCAAGCCTTCCTAGATTACTTAGTTTCT
CTCTATATTTCCCCAGTGTAAAATAAAGATGGCTAGTTCTACTTTTTAAGAAAATTTATA
GAATTAACTCAGCCAAAATAAGTTGTGCCTGATATGTAGGAAGTACTTACTATACACTTC
CTTAGTTCAAAGCTTGGTGGACTATGTTGACACCTGAATCTTAATGATTTATTTCACCTG
GTTCCAAATTCCACAATGGTATTGACCAAAACTAATGTCTGCCTCTCACCCTAAAATCTC
CAACCTGGTTTATTTCTACTTTTGCCTAACTCCTACCCCTAAATCTACAATCTTCTGCTC
TCAATAGTCCCAAGTAACAGAATTTAGCAAGTTTGAGAAGTGAGTCAGACTCTAATTCTT
TTTTAATATAGACCATGCTATGTAACGTAAACTTTATATATAGAGATGGCTGTTTGTAGT
GATAATGTTTTTATTTTTTGAAAGTAATAAATATAAATAACATATAAAGGAATAAAGCAA
AAAAGAAAAACCTTAGAAACAAAAATCATCATCTTTCCACCACCTAATCTTTTTAATCCC
ACTCCTTAACAGTAATTTCAAAACAATGTTAAAAGATAGTGATGAGAATGGGCATCCTGA
CATTTTTCCTGACTATAATGTATATGCTCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved