Homo_sapiens Locus Mono:285:AC012119.8
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:285:AC012119.8
Homo_sapiens
Mono:285:AC012119.8
8
SNORA67L5
1001..1149
2149
AATTCGCAATTACCCATTAAATCACCCTTTTTCCAGTAGCAGTACTGTCCTCTCTGTTC
CACATGTTCCTAATGTAACTTGAGAATAATGTTTTTTTTTCCAAGGTCTTGCATCAATCG
GGGCCCTACTTTAACCCATCTAATTTCTTACTTTCCTCCAGCATACCTTCCCATTCACCT
GAGCTAAAATTTCTTCCTTTCTAACCCCACCCCTCTCCCACCCTCAGTCTCATCTCTCTG
TCTCATAAACACACATGCACACATACACAGGTACACGTGTGTACCTTTGTACAAACATGC
ATACACACACATGCACACATACACAGGTACACATATGTACCTTTATACCTTGCTGACAAT
TGCATTCCCAGCTCAGAGGCTTCCAACTCTTTGTCTATGCAAACTCTACTCATCTTCCAA
GCCTTGCAAAGTTACCTTGTTTCCAAAAACGTTCCCTAATTTGCAAGATACTCTGCTAGG
CACAGTTAAAGAATAAAGATTAATTCTACATAGCCTCTATCCTCAAGGAGCTGGTAATGC
TCACTGGTTCCTTCTCAAAGATACTAGGACGTTTCATCTCACCACAAGCACTTGATTATA
TAAAGAACATCTTGCTATTTTCTATCTCAACCATGGATTGTTAGAACATAAATCGTACAT
TATTCTCCATGATCTTTGCTTTGCTATTCCAATTTAGAGGAGGAGTGGGTGACAGGGGAA
GGAAGACGTGAACACAGGGAAGGGCTCAGATAATAATTTCAGTAGCCTTCAATTCTGGGC
CTAGACCCAAGAGAATAACCAGGACTCTAAGTCACCTAGGGAAAGAATATACATCAAGGC
CCATGTACCATATGTTTAAATATTTAAAAGTATAGATCAAGCTAATAAATAAAATATGCT
CTCTCCCTCCCATCTTGATGAATATTCCCTCACAACAACAAAATTGAAAAGCATGTATAA
AGCTAGGGTTTTAAATGACTAAAAGTCAAAAAATATCAACAATCCAAGGGGATTCCCTCT
CCAAGGGAACATGCAGTGCCCCTCTCAGGAAAGTAACAACCTGGAATAGAATCTGGCATG
CCTAAGGTCTTTGAGGAATAGAGGAATAGAGGATGCTTGTTTCCTCTGCCTTCCTTGGCT
GCCTACATGGACACCTAAGTCTCTTCCCCTCAGGATAGATTGTCCTCTCATGCATATGCT
GAAGAGTCGTCTTTCTTGACATAGGCCAGAGGCACTGAGGTGCAGCAGGTTTCTTTAGTC
ATCAACTATGACCTTCCCACCAATAGGGAAAAGTATATCCACAGAATCAGTCGAGTTGGA
CAGTTTGGCCTTAAGGGTGTGGCTATTAACATGGTGACAGAAGAAAACAAGAGAACACTT
CAAGACATTGAGACTTTCTACAACACCTCCACTGGGAAGATGCCCCTCAATGCTGCTGAC
CTCATCTGAGGGGCTGTCCTGCTACCTAGCCCCAGCCAGGGTTCAATCTTGGGAGGTTGA
GGAGCAGCAGGAGAGGGGAAGGAAGGGAGACAAGAAGTGGACATCTTGTCTCTTTTTTTT
CTTTGAATAAATGTCATTTTTTGAGGCAAAAGAAATATATATATATATATATATATATAT
ATATATGAACAATGACTAAACATAATTATCATTGTCTTTTTCTAATGTTCTGTTTCTGGG
CTAGTAGTAGTGTATAGATCAGTAATAAAAGCAAACATCGTTCATAATTACTACTCGTTT
ATTCCATGAGCTTTATTTTCCCTGCCTTCATTTCAGCAAAATCACTGTTATCATTGAGAT
TTTCATGTTTCATATTCCATTGATAGTAATGAGATTTTAAAATATATTTGTATCAAAGTT
TACAAAATTTCAATATATTTTCAACAAATAGTGAATTTCAAAAAATAAAAAGTTTATTTT
TATAATATGTTTCAGAAAGGTATTTTTTCCAAAGCACACAAAGTAATGCATTAAAATTAA
AAGACAAAAAAAGTAATTTAAAATATCAAAGTTTAAATCAAAATTATTTAAGTAAAGCTG
AATTTTATTTAATTATTTTTACTTAGTTATATCTTACTATGTACTTTATAAAAATAAATT
TATTCCCAATTCAATGTCCATCTACTTGCCAATGAAGAATTAGTATCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved