Homo_sapiens Locus Mono:105:AC006231.18
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:105:AC006231.18
Homo_sapiens
Mono:105:AC006231.18
4
SNORA75L1
1001..1137
2137
ATTCTTTCCTTCATTCCACAGGTATTTGTTCTTCTTGGGATGCTTTTTCACCACTCTTT
TCTTCATTGAGCTAACTCTTTTGCATCCTGAAAACAGTAATCGAGGTCAACATGTATAGC
ACTCACTATATATTCACCCTATTCTAAGTAGTTTATGTATATGAATAAAGTTCATCCTCA
CAACTGCCCTGTAGGGCGAGTATTGTCATTTAACTCATCCTTCAGATGAGGAACCTGAAA
CACAGAAATTAAGTAACTCATCCAAGGCCACACAGCTAGTGAGAGGTGGGGGCTGGATTC
AAATCCAGTACTACAGTCCCAGAAACCATAGTACTCTGAATCACCAGGCTCGAAGTCATC
GTCACCAGAAGCCCTTCTGGAACACTGCTCCTAAATTTTCAACATACCACTTGGCCCTTC
CATCACACCCAGCCCCATGTGAGTATCTGTCATAGGCCTTATCCCATATGATTACAATCC
CTGGTTTCCTCTTCAGTTCCCCTCATTGCCCTGTGATCTCCCTGAGGATCTCAGTGAATC
CCGGTGAAAGAAGGAACATGGCTTTAGGCTGCAGGGGACAGATTCTCCCAGAATCCAAAG
ACATGAGACTTAAAGAAGGTCTTCCTCTTTCATGTCATCAAACTGTTCATTTTTTTCCAT
ACCTCTTTTAGCAATCTGTAACCGTCTTGTTTGTTTTCATTTACTTGATTTAAAAATAAA
ATAAAATAAAAAAAAACTTTTCCTTCCCCCAAGAATGAAGGCAGAGAATTTATCTGTCTT
GTTTGCTGCTTTACTTCAGTGCCCGGCACAGAATGTATATTCAGTAAATATGTGTCAGGT
GAGTAAATGAATGAATGAATTTATTGTGTTTCTGTTATGGGCCAGGTACTGTGTAGACAC
CATGGTTCTTGCCTTCACAAGGTTAACAAGTTTATGGAGGGTGATGGGGAAGATGGCAAG
AGGCAGTAACTATATAGAAATGGAGAAAGAACAGGGAGCTTGGCTTCTCATTGAGCTCCT
TTCTGTCCATTGATGGCAGTTGATGGATTTGCATGAGAAGAAGAGAGAATTCACAGAACT
AGCGTTATTTTACTTTCTGTCTTTACAGAGGTATATTTGGCTGTTTTGTGAGACATTCTG
GGAAGAAAAAACAAACAAACAAAAGAACAGGGAGTTTGGAGAACCAAAAAGAAGAAGGAT
TTAGCATTGGGTGAGGGGAAGTCCAGAAAGGGTTTCTGCAGAAAGTGACAACTAAGAGAC
CTGAAACATAGTTGGGAGATGACCAAGCAGAAGACAAAGGAAAGAGCTGAGTAAGGAAGG
AGAAGAGAGATGTTTCAGATAGAGGGAAGGAGAGGTAGGAAAGGCCTGGCAATCTGGTTA
TTTTCAGGCCTCTTGGGTGCAAATGGTAGAAGGGAGGAGCTTCATGAATTTTGAGCACCT
TGATGTCCAAGCCATGGCAGAATTGGACTTCCCTTCATGTATTCCTTTTTCCACCCCCCA
CCAGCTGTCTTTGTTGCCTTCATTGTTCCCAAAGCCTCCTTTTCATCCTTGTTTATTCCT
GGCTGGAATAGGTTCAGTGGAACCATATTCCTCCGACAGTTTGCATTGCTTCACTTGCTC
AGGAGCCGGTAGCACTGCCAGCTGCCTCTGGGACCGGAATTTCTTACATTTATCTCATGA
GCTATACTTTTCTGTCTATTTTTGCATGTTATCCTTTGATCCTCGCAGCAACTGTGTGAG
TTCTCTCAATTCTTAGCCTAAACCTAAAACGTGTCTATTCTCAGCCTCTTACTCCCATTC
CACTGCGATTCTCTTAAGTGTACTACTCTTCCTTCCTCTTCCCTACACAGATGCTTGAAT
CTGCCAAGAAATTTGCTTCCCTTTCTCTCTCTATGTATATCATTTAAGAACCCCTAAGCC
AAAAACACACCATCTGATGAATACTTAGAGAGGCCAGTAGGGTACAGTATTTATACTCAG
ATCTATACTTTTGATCTGTTCTGGGAGGTCAAAGATATTTGGTCTTAGATTTCATACTTT
GTGTGTTTCCTTTGTTTTTGAGACTGTCTAGGTCTATTCTGTCTTTGGACAGCTTGGACT
ACTTAGACTTTTCTTTTCAGAGTGAGTTTTGATGTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved