Homo_sapiens Locus Mono:149:AC133550.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:149:AC133550.2
Homo_sapiens
Mono:149:AC133550.2
16
2128
GCCGTCCCTGTCACTCACCAGCCACCTCCACGATGTCCCCAGGGACGATGTCCCGAGCC
TTGATCCTTTGCACTGACTTGCGGTCAGCCCGGTAGACCTTCCCCATCTCTGGCTCATAC
TCCTTCAGGGCCTCGATGGCGTTCTCTGCGTTCCGCTCCTGAGGAGACAGGGTGGAGGAG
GCAGGGTTATACACAGGAGGCAGAGTTATGGAGTTGTGGCTCCTGGCACGGGGGAGGCAA
CAAAACCCCACACAGGCAGGGGTGTGTGTATGTTGAGGAAACTGTCACCTACAGGTGAAA
ACAGGTGAGAGGGTTTTGGGGAGGGAACAAAGAAGAATCAAAGAAAATCAGGCCGGGCAT
GGTGACTCACGCCTGTAATCCCAGCACTCTGGGAGGCTGAGGCAGGCGGATCACTTGAAG
TCAGGAGTTCGAGACCAGCCTGGACAACATGGTGAAACCCCGTCCGTCTCTACGAAAAGT
ACAAAAAAAAAAAAAAAAAAAAAAAAAAGCCGGGCGTAGTAGCACGCGCCTGTAATCCCA
GCTACTTGGGAGGCTGAGGCACGAGAATCACCAGAACCTGGAGGCAGAGATTGCAGTGAG
ATGAGATTACGCCACTGCACTCCAGCCTGGGCAAGAGAACGAGACCCTGTCTCAAAAAGA
AAAATCTAAATAAAAAATCAAAGAAAATCAGAGGCTGCCCTGCAGATGCTGTCCTGGACC
TGTCAGCACCACAGACACAGGTGGCTCTGCTGCGCCTGTAACACTGGGGCAAAGAGAAAG
TGCTATTTCTCTCTTTTTTTTTTTTTTGAGACTGGGTCTCACTCTGTTGCCCATGCTGGA
GTGCAATTGTGCAATCTTGGCTCACTGCAACCTCCGCCTCCCCATTCAAGTGATTCTCCT
GCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCACCTGCCACCATGCCCAGCTAATTTTT
TTGTATTTTTAGTAGAGATGGGGTTTTACCATGTTGGCCAGGCTACTCTTGAACTCCTGA
CCTCAACTGATCCACCCGCCTCGGCCTCCCAAAGTATGAAAGTGGCTATTTCTATCCTCA
GTGTTCAGAAACCAGTGAGCACCAAAAAATGGCTTATAGCCTGACATTTCTTAAAACCAA
AGCAAGGTAGCATTTGGGTTTTCACTTTGGAAATGACCTAAAAACAAAACAAAACAAAAC
AAACCAGGAAGCAGAGGACAGGACATGTAGGGGGTGGTCAGGTCAGTGGAAGAAGGAAAT
CAAGCTAGCGTCTATTGAATTCCTACTGTGTGCCAGGAACATGCATCATCTTAGTCGATT
TCACACTGGATTGCTAGCCCCATTTTATGGATGAAGAAACTGAGGCTCAGAGGGATGAAG
GAACTTGCTCAGGGTCACATAGCCAGGAAGTGACAGTGGGTCACAGTCTCCCACCTCTTC
CCCACACTCCATCCCATTCCAGACCAGGGGATAGGACCAGAGGAAGAGGCAAGTATGGGG
GAGGTGATGGAGGAGGAGGAGACTGGAGGGAGGGTTGGCCTCTTCTTCACTGTTGGGACA
TGAAGGGGTAAGGAAGGGTCAACGCTAACCTGCCAAACCCCCACGATGGCATTGGCAATG
AGGATCAAGAGGATGACAAAGGGTTCAACAAAGGCAGTGATGGTCTCTTCACCTTCCTCA
AACCAGGCCAGCACCTGGGGAGCAGGGGAAAGGAGAATGACAGGTAATGAGGCCCCAAAA
CAGATGGAGAAAGGAAGTGGACCACTGCAAAGGGGAGAACTGTGCAGGAGAGTGCAGGAG
CCAGCAGGAGGGCCGGGCACCGTCGGGGCGCTGTGGCCCCACATCCGTCTGAGGGTCTGT
CCATCCACTGCAGGTCCTGCCACCGCCTTACTCAGCGGGATGGGCGCGCACAGACTTGCA
CCACTTGGGGGATTAGCTGGGAATGCTTTCAGGTTTCCCTGACCAAGCTGCTGGCTTAGA
AGCGAAGCTCAGGCCAACCCCCCGCACAGCCACATCCATCCCACGGGAGCCAAAACCCGA
GAGGAAAAACCCTGTGGTCTTCGCAGGCGGTCTGGCCCCCGCAGCCCTCCCCCTCGGCCA
AGGCAGGGAAGCTCCGGTTTCACGAGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved