Homo_sapiens Locus Mono:268:AC023855.15
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:268:AC023855.15
Homo_sapiens
Mono:268:AC023855.15
17
SNORD3@L21
1001..1203
2203
CTGTAGTCCCAGCTACTCAGGAGGCTGAGGTGGGAGGATCACCTGAGCCTGGGAGGTCA
AGGCTGTGGTGGCCCATGATCACACCACTGCACTTCAGTCTAGGTGACAGAGTGAGATCT
TGTCTCAAAAAAAAAAAAAAAAAAAAAAAAGAGTTCTTTTCCTCAGTTGAGGATTAAATG
AAGCCTTTAACGAGATGCCTGGCCCTTCTGTGTGGCCGTTACTATTCTCTTAAGAGTTCA
CTGGGCAGGGCTAGTGAGCACTCTGGGAAACCTGGACAGGACGTTTGGGCTCCTAGAGCA
AGGCAGAGGTACTAGGCACAAATACTGTGTTCCAGGAGATGCTGGGCACCCCTCAAGTGC
CAGGATGAAGTGTTTTGACTTTTGGCCTAGTGAGAAGAAAAAGCATTCCCTTCCTTTGTG
CCTAAGACAAGACCTGGGTGAATTATAGATGATGGCAGATTTCTCAGGCAGGCAGTATAG
AATGAAGGAGGAGACACCTGACTCCTATCCGAACTGAGGGAGGGCCCCAAGGGGCCTCAA
GCTGCCATTCTGATGATACAGAGCAGGTTGTGGGTCTCCAGAAGGAAGTGAGGAAAGAGG
CTGGGGGTGAGCTCTGCTCCCCTGGATGCAAGGCCTTAAGGCTGGGGATTTCCTAAGCCT
GTCCCACATGCTCACCCTTGGGGCTGCGGCTTCCCTGAGAGCTGGGCTCTGGGAGGAGGC
CAGATAGGCAGGAAACTAGAGCCCAGATTCTTTCCACTGCCATTCCTGGGCTGGGGCTGC
ACTCAGGTGCAGGTGTTGCCAGGAACACAGGTGAGTGCATTGGACTTTCACAGCCTGAGG
CCCTATCCTCAGTGGCCAGACAGGGCCAGGATCTAGTTGATGCTCTGACCTCTGGCAGAA
CGGGAGCTCCACAAATGTTGGCTGCATGAGAGCAATTGAGTGCATGTTTGGGGGCCGGGG
AAGGCAGAGTTTCTCCTGGGTCCCTCTAGAAAGTCAGTGAGAAGCTTGTACTCTCAGTGA
TCATTGCTGTAGTTACGAGATAAGCTTCTCTGAACATGCAGAGCAGTGGTAACTATGAGG
AGGCACAGTCTCTCCTGAGCATGACTCTGGCTGTTGGTGTGGCTTTGCTGCAGCTGCCGT
GTGCCATTGATGATCCTGCTCCTCTTCCTTCGGGAAAGTAAGAGGGAGAGAACAGTCTGA
GTGGGGGTGAAAGTCAGTGAGCTGCAGTGTGGGGTGGGAGGAAGGAGGTGCAGAGGATTA
CAGGCCATCTTCCCTGATTGCTCCTCATCCAGCAGGAAGAAGGAATGAGAGGTGGTTAAG
GGAGGGGGATCCGAATGCTGGGGTCTCAGGCCAAGAGGGTTCTTGCCAGAAGCTTAGGTA
ACATTTAAAATCATGGGAGGTGGAGACAGGGTGTCTTTGAGTTGATGTTTGGGCACCCAG
CAAATGGTGAGACCCCGAATGGCATCTACTTGTGTTTTTCTCCCCTAGCATCACTGTGCT
TGCCAGGGTCCCAGGCGGAGGAGTGAGGCCTGAAGGTCTCAGCAGCCATGAGTGCTTGAT
GCCATCCTCACCCCAGCCCTTCATGCAGCAAGGACGGGGTGGGTGTGGCCACACCTCCCT
CACAATGGCTATAGTCATGGTGGCATCAGTCTTTCTCAGGAGTCTGGTGGCAGCATGCCC
AATACCATGCACCTGCCCTACCTCAGGCAGCGTGGTGGACTGTGGGGGCCTCCACCTGCT
CTGTCTCCCTTCCAGGCTGCCTGATGGAGTCTGGCTCCTGGAGCTGAGCCACAATAATCT
CAGCCATCTGCCGGCTGGCGCCTCCAGGGCTTTTGGGGACTGCGGGTGTTGCTGCTTTCT
CTCAATATCCTGCGGGATCTGTCTGATGGGGCCCTAGGGGGCCTCAGTTTCCTGGAGCAG
CTGAACCTCAGCCATAACCAGCTGGCCCATCTGCCCACAGACTTCTCGGCTACCCTGGGC
TCTCTGCTCTGCCTGGACCTCTCTCACAACCTACTCACTTCCCTGGACCCCACCAGCCTG
TGGCGCCTGGGGGGCCTGGAGCAGCTCAACCTGAGCCACAACCAGCTGGCTGAACTGGCC
GCAGGGGTCTTTGGGGGCCTCTTCCACCTACACTGGCTCTCGCTGGCTGGGAACCAGCTG
CAGCGGGTGAAGGGTGCTGCCCTGACCACTGTGCCGGGCTTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved