Homo_sapiens Locus Mono:130:AC091826.3
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:130:AC091826.3
Homo_sapiens
Mono:130:AC091826.3
5
SNORA70EL3
1001..1136
2136
CCTATGTCAGACCATATCATGAGCCAGTACATATAGGAACATATAACAGTCTTTCTATC
TTTCTGGGGCTAGAATGATCACTCATGAAAGATTACTAAGAAGTGATATTTTGCAGACCT
TATTCAAGGTTGATAAAATCCAAATTCTTGCCTTTTGGGTCTCTGAACAGCACCATGGTG
GCTGGCAAGAATAAGCGTTTTATGAAAGGTGGCTAAAAGGAAGCCAAGAAGAAAGGGGTT
GATCCATTTTCTAAGAAAGACTGGTATCACGTGAAAGCACCTGCTATGGTCAGTATAAGG
AGTATTGGAAAGACACTAGGATTCAAGGAACAAGAATTGCACCTGATGACCTTAAGGGTC
ATGTGTTTGAAGTGGGTCTTGCTGATCTGCAGAATAATGAAGTTGCATTTAGAATAAACT
AGCTGATTACTGAAGATGTTCAGGGCAAAAACTGCCTGACTAACTTCCATGGCATGGATC
TTACCCATGACAAAATGTGTTCCATGGTCAAAAAATGGTAGACCATGACTGAAGCTCATG
TCAATGTCAAGACTACCGATGGTTATTTGCTTGGTCAGTTCTGTATTGATTTTATAGAAA
ATGCAACAATCAGATACAGAAGACCTCTTATGCTCAGCACCAACAGGTCTGTCAAATTCA
GAAGGAGATGATGGAAATCATAAACACAGAAGTGCAGACAAACGACTTCAAAAAAGTGTT
CAATAAATTGATTCCAGACAACATTGGAAAAGACATAGAAAATGCTTGCCAATCTATTTA
TCCTCTTCATGATGTATTCATTAGAAAAGTAAAAATGCTGAAGAAACCCAAGTTTGAATT
GGGAAAACTAATAGAGTTTCATGATGAAGTTAGTTGTTCTGGAAAAGCTACTGGGGACAA
GACAGGTGCTAACGTTGAATGAGCTGATGGATATGAGCCACAAGTCCAAGAATCTGTTTA
AAGTTTGATTTTAATAGTGGCAAATAAAAAAGCCTATCTGTCTGCAGCCAATTGAGTTGA
CCGAGCTCTTTTCCTCCTGGGGGCTTGGTGTGCAATGGCTGCAAACAGCAGATTCCTTGG
TAGTGTATGCAGCCTGCTTCTTGTATGGGTTGCCTCTAAGGGACCTTGAAGGCAGCCCTT
TCCAGTGTATGTTCATGTCTCTGACCTTATGCTGTCCCAGTGTAGGCTGTAGAGAGGTGT
GCAAGCTGCCTTTGGAAAGTTTCAGAGTATCATAGCCTGGGTTCATATTGGCCAAGTCAT
CAGGTCCATCTGCACCAAGCAGAACAAGGAGCATGTGATTGAGGCCCTACACAGTGCCAA
GTTCAAGTTCCTGGCTGCCAGAAGATCCACATCTCAAAGAAGTGGTGCTTTATCAAGTTC
AATTTGAATGAAGTTGGAGACATGGTGGCTGAGAAGTAGCTCATCCCAGATGACTGTGGA
GTCAAATACATCCCCAATTGTGACTCTCTGGACAAATGACAAGCTCTGTACTCATGAAGT
CTTCCACTGTGTGGCCATCTCCTAATGCCAACCAATAAATCCTATCCATAAAAAAAAGAG
TTCTATTTGTGGGGAAAAAAAATCCAAATTCTTTAATAAGGTTTCTAACTTCACAGATTC
CTGAGTCAATGAATTTGACACCAAGATCCTTATGCAATAAGAAAGCAATGTTTCCTTGGT
CACTCTTCTCCTACCTTTCTCTAGACACCCAAACCCCTAAGGTAACCATGAGCTTTTCAT
GGTGGCATCATTCCATGGAATTCTCAGGTCTCTAATCTAGTTCCGGACAGTAAATGAGTA
CTCGATATTTGTTGGCATTGCATTCTGGGACACCCTCCCCACATTCTTCATGTTCTAAAA
TGACCTTTCGCTTTTTTATTGTTCTTTCTCTGTTTTCTGCCCTGCAACCTCACCATGAAC
AATAAAACTGAGCTGTCACTAACTAATATCCTCCCATAACAGAGAGCCAAGAAAATTGAT
TATTCATTTAAAGTAATTCTTACTAAAATATGAATGGCCAGAAAGTATATTAGCTTATAT
TTTGAAAGTAGAAAAGATATTCAAATTATTTCATTCAATATGGTAGGAATTACATCTGTT
TTGTTCCTTCTCAGATCTCTAATCCAGTGCCTGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved