Homo_sapiens Locus Mono:223:AL390877.9
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:223:AL390877.9
Homo_sapiens
Mono:223:AL390877.9
1
SNORA40L4
1001..1122
2122
TTAAGATATTCATTACCTCAAAAATGTATCATTTCTTTATGTTGGGACTATTTCGCATC
TTCTCTTCTAGCTATTTTAAAATATACAATAAATTAGTATTAACTATAGTCACCCTACAG
AACTATTGAACACTAGAACTTATTCCTTCTATCTAACTACATGTTCACACTCATTAACCA
ACCTTTCTTCATTCCCCCTGAACATCCCTTCCCAACTTCTGGTAACCATCATTCTACTCT
CTACCTCCGTAAGATCAACTTTTTTAGCTTCCACAGATGAGTGAGAACACGAAATATTTG
TCTTTCTGTGCCTGGCTTATTTCACTTAATATGTTGACCTCCAGTTCCATCCATGTGGCT
GCAAATGACAGGATTTCATTCCTTTTTATGGCTGAATAGCATTTCATTGTATATATATAC
CACATTTTCTTTTACCCCTTCATTCATCAATAAACACTTACATTGATTCCATATCTTGGC
TTTTGTGAATAGTGCTAGAATACACATGGTGCGCTGGTATCCTTTTGATATACTTTCTTT
TGGATTTGCTTTCTTTTGGCTAAATACCCAGTAGTAGGAATGCTGGATTGTATGGTAGTA
CTATTTTTAGTTTTTTGAGTAAACTCCATACCATTTTCCATAGTGGCTATACTAATTTAC
ATTTCTACTCACAGTGTATAAGAGTTCCCTTTTCTCTGCATCCTCATCCATATTTGTTAT
TTTTTGTCTTTTTTTATAATAGCCATTCTAACTGAGGTGAGGTGGTGTCTCATTGTGGTT
TTGATTTGGGTTTCCCTGATGATTAGTGATGTTGAACCTTTTTTCAAATACCTGTTGGCC
ATTTGTATGTCTTCTTTTGAGAAATGTCTATTTGGGTCTTTTGCCCATTTTTAATGGGAT
TATTTGGTGCGGGGAGAGGTTGCTGTTAAGTTGTTTGTAACTCTAATTTTTGTACAACAA
AAATTTTGGAAGTTTTAACTAATAATAATAAAACATATGACTGCACTTGTGTTTTTGTTT
AACTGTGAACAAAGACTTATAGAGAAGTGCAAAAAATAAATCCTCTTTTGCAACCCAGAA
CTCATTGTTTAGTAAGGGTTTTGATACATATAAAAGAGATATTACAATTTTTTAAACGAT
GAATTTTCTAATTTTTTTAGAAATTTTTCAACTGTGTCAGCATTTGAAAGCTACTAGACT
CATTCCCTGAGACATGAAAACATGGATGGCATTGTAATTTCTAGAACTTCTTGTAAAATG
AGATTTTTGTGAGTCTCTGCTAAACTTATCCTTCTGTTTAAAACTTTTTCTATTTACTTA
TATGTTACTTCAGATGAATTTTTTTAATTAAAATTAATAAGAAGTATGAGCAAAGATAGC
GTGACATACCTTATTATATTGACTATTGAGGATAAATATGCAAAGATTAATTTTGATAAA
ATTATTTACAAGTTTGCAAAAGTTACAGCCTGAAAATGAAAATTGTGATATATTATCATT
CATTACTGTGACAGACCAGTACACAAGTCTAAATTTATTTTTTCTCCAAAAAATTAATGT
AATAAAAGTATTATTTCATTACTTTTCCCTTTATTATACTGTAATAATTATTTTGTATCA
TATTGTTTATTTATATTTTATTAGCATCACTGTATATACACAGTTTAATAAATTGTTTTT
TCACTGTTTGCATTTCTTTCTTGGCATCATCATCAGCTATATTGATGCATACATTAACTG
TATTTCATGATTATCAATGAAAATAACTTTGTTGGGGAGGTGTTACAAAATTATTCACTT
CAGGTATCTAATATGCCAGACATCTCACTAGCTGGCTGATCCAGGGCACATAACTGACCA
AACTGGGGCCCCTCGACTCCCTCCCCAGGAAGGTGAAGCATGGCTCTGAGCAGCAAGGGG
CTGGACTCAGTGGAAGCTGAGTCGTGTGATCAGCAGCACCATAGAGTCCGTGAACTCCCA
CCATAGAGGCCCTACAGCGGCCCTGCTCTGACCTTCCCACAGCCCCCTTGGGTTGTGAGA
TACTCCAGAATCATTCCAATAAACCTCCCTTCTGCCCCTTTTGCCCTTAGACCCAGGATC
AGTTTCTACTACTAGAAGAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved