Homo_sapiens Locus Mono:58:AC124303.5
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:58:AC124303.5
Homo_sapiens
Mono:58:AC124303.5
15
SNORD115-19L1
1001..1059
2059
TTTTGTGATTATTGGTATCATCTCTATGATGTCATATTACCTAGATTCACATATTCTTA
ACTCCATTAAAATAGAAATTATATTTGTGGGCGGGGAACTTATTTTCATCCATCTCTGTT
TCCTTCCAATTGAGCAATTCCTTATTTTATGTTAACCTGATTTTAGTGGTTCATTGCCAT
AATTCTTAGAAATTATATCTCATTTTTTCCTGTGATTTTACTGTATTGAAGTAAATCTGG
TTGGCAGGATATACAATATTACATGAATGAAATTTGCCTTTGGTAACTGAGAAAGTTCAA
ATAGACCTTGGTTCTAGCGAAGACTTGTTTCTAAGGAATTTAGATTCATTCTTTCAGACA
GTATGAATATCATTATGGGGTCTTCTTCATGAGTTATGTATGTGATGGGATTCTTGTAAG
ATTTTCACCTTTTACCTGAGCTTGCCTTGACTGAAAGTTGAGAAAATTTTGTGATTCATT
GGTATAATTTCTACAGTGCAATATTTATTTGGATCTAAGCATGCAAGTAAAAAAATTCAT
CCCTGTTATAGTATTTCAGGTTTGCAGTACGTTATGACATTTGTAGATCATTGATGGACT
ATGAATATTCAAGGGACCTGGCAATTGTACCCAGGGGATTGAGATCCAGATACTTGTTTG
TTTGCCCATAGATATAAAATTAGGAGCTTCCTGATATCTAATTTACTTTTTTAGGAATAA
CACCCATGAGATACAGTTCTCATCTACTGCCCTACTCCTGTCCTTAGATAAATAACACCG
GAAGAAGAAGACTCTCTGGCCTCTTACATCAGGGACACATGAAAAGCCACACTGAATATG
TATGAACTCCAATATACTTTCACAGAAGGGTTTAAGGATGCCATCCCTGGTTATAATTTT
TAGGACCAAATATATATATATATACACACATACACACACATTTAGGATAGATATATATTT
AGGATATATAGGATAAATATATATATTTAGTGCCATGGTTTGGGTCATGAGGAGGTTTGA
TGACATAAAAATTATGCTCATAAGTATTATGCTGAGACCCATTCTTGGGAGGAGATGTGG
GGGTGTCCTAGGCTGTGCAAAACATAGCTATGGAAACAGAAGTTATTAAGAGAAAAGAAC
AAGCAGTCAGTGAGAATTTAGATAAGAGACTGTAATAGAATAAAAGTATCAGATTAGTGA
ATGGTTGTCCTAGTAATTTGGAAGAAAAGGAATAAAAAATGGAGTCAGACTACTAAATGG
CAAAAATAAAGACTTGAAGAACTTAATTTTATACCTGAGCTTTGCTTTGATTGAAAGTTG
AGAAATCTTGTGATTTGTCGGTATCATCATCTCAAATCAACTTATTTTTCATCTCAACAT
GAAGAATATCAGCTCTAGCCTTTTGGAATTTCAGCAACTCAGATGCTTGTTAGAACTTAT
CCAGGACTGCTTGCAGGACCCAAAATACTAATAATCCATATGCCTTTTTTTCCAGCTGAA
ATTAGCTGTCTTAAGAGTTGTTTTTCAGTGCTCTGAGGATATCCACAAATATATCCCAAG
GCACTCTGAAGTGTGTTTTCAATCTTTGGCCCTGCACACTGGGGATGCCCACTGGATGTT
GCATGGAGTGTTGCCTCCAGTTGACTTTGATAGACACAATAAACACCACGTGAGAGCCCC
CTCATGAAGGAGGGCTGAGGACTTGGAGTCCAATTCTCCACCTCCCCTGACAGATAGGCT
ATTCAATGCCTTGGGAATCCGACATGAAGGACTGCTTATAGCAGTCCTTGAAAACTTTCT
ACAGAATGTGAACTGGGAGAAGCTAAATGCTGTACTCACAAGCTGGGTGACTTCTCCATT
GATTTTTACCATAGCTCACTGAAACATTTTCTAAATTAACAGGTATAAATTCACAGACAG
ATCAGAATAGATCCTTGGTCCTTTCCATTTTTCTGGCACTTTTGTTGCCAGGAATTCAAA
TACAACTAAGAGAAAAAGTGGGTAGCTAGCAAGAACAGATAGTTTCTCAAATATTAGTGG
CAGTAACCCAACTTTGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved