Homo_sapiens Locus Mono:316:AP004146.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:316:AP004146.2
Homo_sapiens
Mono:316:AP004146.2
11
SNORD39
1001..1071
2071
TCACTTTACCCATGTCACTCCTCCCTTAAGAATGTACAGTGCAGTGCTGATAGTAATCA
GTATTAGCCTGTGAGTTCTCTCATGAGGAAAAGGAAGAAAGAAGTGAGTTTCTGATGCCT
CCGTGGAACCTGGCATTAGGTTCTTCATTACAGACACTGGCAACAAGCCTAACCCACAGG
CCTCTGGCATCAGGCATGCCTCTGCCAACTCAAGTACCAGGTCTACCTCTATGGACCCTG
GCACCAAGCCAATCCACCTAGGTACCCTGACAATGGTCCACCCACCTACAGACTCTAGCA
GAAATGCCTACTCAGAGACCATTACAGCCAGTCCACTCAGAAATGCTGGCTGGACTGACC
AACAAAGTGCTTTGCTTGATGAAGCCAGTGTGTAAAACTAAAAGAAGTGACTACTTCTTC
AAATGCACAGATACCAAAGCAAGGCTACAAGATTTACAAAGAATCAGGGAAATAAGATAC
TACCAAAGGATCAAAATGAAGCTCCAGTTACCAACTTTAAACAAATAGAGATCAAAATGA
AGCTCCAGTTACCAACTTTAAACAAATAGAGATCCATGAATTGCCTGACAAATTATTCAA
AGTAATTATCTCAAGAGCGCACCATGAGCTAAAAGAGAACAATTATAAACAACTAAACAA
ACACAGGTAACAATACATTGGGGAAAAAAGAGATGCTCAGCAGAGACACAAGCCATAAAA
AAAAAAACCCAACAGAAATTCTAGAGCTGAAGAACACAATGGCTCAGCTGAAAAACTTAA
TAGAGAGCTTCTACATTAGACACGATCAGCCGAAGAAGGAGTCAGCTAGCTCAAAGACAA
GTAATTACCCATTTCAAGGAACCAAAAAAATTCTTTTTAAGAATAAAGAAAACCTTATAG
TACTTATTAGCCACCACTTAGCAAAATAATATATGCATTAAGGGAAGCTCTGGGAAGAGA
AGGGAGAGAAAGGGGTAGAAAGCTTATTTAAAGAAATAATGCATGTATAATGATATATTG
GTAACACTGCAGACTTGGGGAAGCCAGCCAACCTTGGAGATCTGAGTGTGAGAGAAAAGA
ATATGAATAAGAATAAGAAGAGAAAGAGTAAGGAGAAGAGGAGAAGGAGTAAGAGGAGGA
GGAGGAGGACAAAGAGATAGAATAAAGAAGGAATGGGTAAAACTTCCAAAATCTCAGGAG
GGAACTGGATATCTAAATTCATGGAACCAAAAGGATCTCAAATAAGTGACACCTAAAGAG
GGCTGCACTGAGAAATGTTAAAATTAAATTTTCAAAAGGCAAAGGCAAAGACACAATTTT
GAAAGCAGCAAGAGAAAAGCTGATCACATGCAAGAAAATCTCCGTAAGTCTATCAGCAGA
TTTCTTAGCAGAAATCTTGCAGGCCTGCAAGATTCAAAGTACAGAAAGGAAAGAAGAAAA
AAACAAAAAACCTGCCAACCGAGAATACTATACCTGACAAAACAGTCCTTTTAAAATGAA
GGAAAGATAAAGACTTTCCTAGATAAACAAAACTGACAGTTTGTCACCACTAGACCATCC
TGACAAGAAATTCCAAAGGGAGTAAATAGAGTTCAAAAACAAAAGAATGCTAAAAGGTAA
CATGAACAAATATAACAGTATAAATCTCACTGATAAAGGCAAATATATAAGCAAATACTG
TAATACTGTAATGATGATGAATAAGTCACTTTTACCCCAGTATAAAAGTTAAAAGACAAT
GGTGGCTGAGTGCAGTGGCTCATGCCTGTAATCCCAGTACTTTGGGAGGCTGAGGAAGCT
GGATCACTGGTGTCAGGAGTTCGAGACAAGCCTGATCAATATGGTGAAACCTTGTCTCTA
CTGAAAATACAAAAATTAGCCATGCGTGCTGGCACGCATCTGTACTCCCAAGTACTTGGG
AGGCTGTGACAGGAGAACTGCTTGAACCCTGGAAGCAGTGGTTGCAGTGAGCCAAGATCA
CGCCACTGCATTCCAGCCTGGGTGACAGAACAAGACTCCATCTCAAAAAAAAATAAATAA
ATAATAAAGACATGGTATTATAACTATAACCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved