Homo_sapiens Locus Mono:3:AC012588.14
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:3:AC012588.14
Homo_sapiens
Mono:3:AC012588.14
18
SNORD3@L29
1001..1213
2213
TACTCTGTGACATATCTTTTATGAAAACTTTTATCAATACTAAAGAATCATGGCCAGGC
GCAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGATCATTTGAGGCC
AGGAGTTCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAA
GACTAGCCAGGTGTGGTGGCGGGAACCTGTAATCCCAGCTACTCAGGAGGCTGAAGCAGG
AGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCCAAAATCGCGCCACTGCACTC
CAGCCTGGGTGACAGAGCAAGACTTTGTCTAAAACAAAACAAAACCCCCAAAAAACCACT
ACAGAGTCATTATTCTGTCTGTTGTCAGTATCCCAAAGTTCCCGTTTCACGTATAAAGTC
TTCATCACATTAATTTCTAGGTAAATTTACCATCTCCCAACATGTAGTCTCTGTAAAAAT
ACCAGCTATAGAAGTTATCTGAAAGCAGCTGACTTCTATGATTTCTGCCTATACTTTCTT
TCTCTGTCTCCTCCCTCAGGGAATGCTGGAAGAGGAGACAGGCCCCAGATTTGGGCAGGA
AGTAAACAGTTTTCAGGCTGAGGCCAATCTGAGCAGGAACATTCCAATATTTCTTCAGCT
ACGTTGTCCCAGCACTTCACTGGTTAACCTTTTATGTCCACCATTTGTGGATTTCACAGC
TACTTGTCAATGGTGAATATTGATCATCATCATTATCTACTGAGCTGCTACCATATCCCA
GCTACTCCTTGCATGTTGTTCATTATTTTCTCAACACTCAGCATATTTGCAATATGTTAT
GTAATATCACAGACAAGGAAACTGAACGCAGAAATGTTTTATTTCTTGCCAAACATCACA
TGAGGATGAACAATGAAACCGATTTGAAACCAGGATTGTCTGATTCCAACATCTCTGGGT
CCTTTTTCACTCTGATATGCTGCAATTAAAAAGCCATTTCTAAGACTGTACGTTCCAAGA
TTGTTTCTATAGTTGGTTGTGAGAGAAGTTTCTCTGAACTTGCAGAGCACGGGAAACCAG
GAGGAGGAGGCTCAGGGTGCTCTCCACACGTGTGAAACCGGCTGTGGGTGTTGCTTTCCT
GTGACTGCCATTTGCCACTGATGATCTTCTCTTCCTCTGGAAGAGTAAGAGGGGGAAGGA
CACAGTTTCAGTGCTTCCCATTTATAATTAATTAATTAATTAAGGGCAGGTGCAGGGGCT
CACACTTGTAACCCCAGCACTTTAGGAGATTGAGCAAGGAGGATCCCCTGAGCCTGGGAG
TTTGAGATCAGCCTGGGAAGCAGAGTGAGACCATGACTTAAATAAAAATTTTTTTGTGTT
TTGTTCTAATTTTTACTTTTTTGAGACAGGGTCTCGCTCTGTTGCCCAGGCTGGAGTGCA
GTAGCGTGATCTCAGCTCACTGCAACCTCTGCCTCTGGGTTCAAACAATTCTCATGCCTC
AGCCTCCCAAGTAGCTGGGATTACAGGTGCCTGCCACCATGCCCAACTAATTTTTTTGTA
CTTTTAGTAGAGACGGGTTTTCACCATGTTGGTTGGCCAGGCTGGTCTCGAACTCCTGAC
CTCAAGTGATCCGCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCA
CGCCCGACCAAAAAAAAATTTTTTTTTTTCAATTAGCCAGACATTGTGGCATGTGCCTGT
AGTCGCAGCTACCATGGGGGCTGAGGTGGGAGGATAGCTTGAGCCCAGGAGTTTGAAACC
AGCCTGGGCAGCAAAGTGAGACCCTGCCTCAAAAATAAAAAATAAAAAAAAAGCTATTTC
TTACAGATATTCATTGAGTGGAAAGCAATTTAATTTTACGTATAATAAGTTATTTCAAAA
AGAATTGTAGTTATGTGTGGCAATTTTTCATAAATACCTGATACAAATCAAGATCTACCA
TGGTAAGTGTGCTCCAGAGATACCCTTCTTGACCAAAACAAAGCAGGGCAGGGATTGGGA
GGCCTTTTGGGCTGGGCTCCAGGACACAATGACTAGAAGATGATGCAAAGTGCATGACAG
AGTAGAGAGCTACACAGTTTACACATATTAGACTCTGCACATATTAGAGTCTACACATAT
TAGACTCTGCAAAAGTAGTTCTTAAATGTTAGCTCACATGCACCCCAGTCACGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved