Homo_sapiens Locus Mono:175:AC068985.17
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:175:AC068985.17
Homo_sapiens
Mono:175:AC068985.17
3
SNORD118L6
1001..1136
2136
TAATTTGAATGGTAGGTTTAAGAATTATCTTGGATTTTCTGTGTAGACAATTATATTGT
CAGGATATAAGTGCTGTTTTTTTATATTCCTTTCCTGTTACTACTATCGTTTCATTTGTT
TTTCTAGGTCTTCCAATAGGCTGTTGAATGGAAGTCATGATGAATATATTCTTTTCTTGT
TTCTAATGTTAAAGAAATATCTTCAAAGTTTGTTTGGCTTGTTGATAGATATCCTTTATC
AAGTTATGTTGGTCATTACTGTTTGTTCTTAGATCTCTGCCTTTTTCTTGCAAACTGCAT
CTCCCAGACACTCCCAACTGGGCTTCTGCTATGTTTGGCCAATAGAATGCGCTGTTAGGA
GACAGGAATGGAAGAAAAAGTGAAGTTGGGAAGTTTCTCTCCTACTCTTGATGCTTCTTC
AGGTAGTATCTGACAGGAGTTTCATCTCCTAGAGACAGTTCCTTTTTCCATGGTCCTCGT
TCATGCCAGAGTCTTTATATACATCCAGCCCTTGCCTGGTAGCCTTAGGTCTTGGCATCT
ACCTACATTACCTCCTCCTTTTGTACCTCACATTAGGAATGTTATAGCTTCCTGCTTCAT
TAATGTCTGTCACCTTTTAGGACTTTGCACTCTCTCCACACCTCTGTAACTAGTTCCTTA
TGTTAAATTCTGTAAACAGGACAACTTGGTATGGGATCTATCTTATTGACTGGACCCCAA
TAATACATCAGATTAGAAAAGTTCCAGTCCCTTCTTTGTTTGCTAGTGGTTTTGTTGGTT
TGCTTTGTTTTTTGTTTTAATATAGTCAAATTACATTTTACAAAATCATTTTTGTTATTG
AGTTGCTATATGTGAACAACTGAGAATTGTACATATTATTTCCCTTTTATTCTGTTAATG
TGGTATATTAAATTTAATAGACTTCCTAAAGACACTTCATTTTTGCACTCCTTGGGTGAA
CCCTATTTGTTTATGATGTCCTTTTAAGAACATTGTACTGATCGTCAGGTGGGAGAATTC
TTACATGTTCCTCCTTTTGCAAGGCAGATTAGAACATGATGATTGGGGTTCGCATAATAT
GTGATTAACGTTTCTGTGTAATCAGGACTTGCAACATCCCGAATGCCCTTACCTGACACT
TCTTAAAAAAATAAATAAATAAAAACACAGTGCTAAATTTTATTGTTTGCTGTATTTTAA
AAGAATTTTTGCATCTGTGTTCATGAGTGTAATTATTCTATAATTTTCTTTTCTCGTATT
GCCCTTATCTAGTTTAGTAATGCAATTTCAGTGCTCATTGTGAGTTTAATTTGTGTTCAT
TTCAAAGGTAATTGGTTATTTATTTCAGCTTTTAGGACTCTTCATCCTTGACAATTACAG
TTCTATTATGATTTTACTCTTTTGAATAGTTACCTCTTTAAATATTACTTCTGCATTGTT
TCCTTCATGCTTTTATTATATTCCTGTGAGATTTACATTGGACACACTTTCACCTCTGTG
TCACTTAAAAATGTAATTACTTCTTTTAAGTAATACCATGTTTTTATTTTATTTTTGCAA
GTTGAATTTCTTAGATTTTAATTCTTTTTTCATGGATATGATTCATTTGTCAATTTAAAT
ACTGTAAATATTGATTATAAATTCTTTGTCAGTTTTTTAATAAAATTAATTTTATCTTCA
TTATATTAACATTCTGATTATATATTTTTTCTGGTTGTCTTTCAGAGCTTTAGATGTGGT
CCTAGTATTTTGATTTTTAGCCTCATTTTGAATGGTAGTTTCTTTCCCCCTTTTATCTCC
TTCTCTGCTTGCTCCTCTCTAATAAGTGTTTTTTTTGTTTCCACATAGGCTCCAGGTCCC
CAGTGAGAACCAAGTGTTTTAATGTATTTTGGTGCCTCTACACTGATATAATTTTGGTGA
TATTGCAGATCCAATCACCAAGCCAGCTATTGGCTTAGTTCTATTTCCAGACTTGAGCCT
GTGTTTGTGTCCTACTACCTTGCCAATTGTGGTAGGCAGAATAATGGCTCCCAAAGATGT
GCAGATCCTAATCCTAATCCTTAGAACCTAGGAATATGCTACCTTATGAGGAAAATAGAC
TTTTGTAGATGTGATTAAGGTTAAGGACTTGATATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved