Homo_sapiens Locus Mono:225:AL135927.14
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:225:AL135927.14
Homo_sapiens
Mono:225:AL135927.14
1
SNORA26L7
1001..1114
2114
AAAACTGCAGCAATGGGGGACAACCTGAAGGTGGAGAAAAATGACATTAAGGTGGAGAA
AAATGACAGGGTTAGTGGGTTTTCTCCTCGTGTGCGGAGACGAGAGAGTGTAGAAATAGA
GACACAAGACAAAGAGATAAAAGACCGCTGGGCCCGGGGGACCACTACCACCAAGACGCG
GAGACCGGTAGTGGCCCCGAATGCCAGGCTGCGCTGATATTTATTGGATACGAGACAAAG
GGGCAGGATAAGGAGTGTGAGCCATCTCCAATGATAGGTAAGGCCACATGGGTCACGTGT
CCACTGGACAGGGGGCCCTTTCCTGCCTGGCAGCCGAGGCAGAGAGAGAGAGAGGAGAAA
GAGAGAAACAGCTTACACTATTATTTCTGCTTATCAGAGATTTTTAGTATTTTCGCTAAT
TTGCTACTGCTAACTAAAAGGCAGAGCCAGGTGTACAAGATGGAACATCAAGGCAGACTA
GGAGCGTGACCACTGAAGCACAGCATCACAGGGAGACGGTTAGGCCTCCGGATAACCGCG
GGCGGGCCTGACTAATGTCAGGCCTTCCACAAGAGGTGGAGGAGTAGAGTCTTCTCTAAA
CTCCCCCGGGGAAAGGAAGACTCCCTTTCCCGGTCCGCTACTGCTAGACCACGGTCCGCT
TGGCAAGGGGCATCTTCCCAGACGCTGGCATTACCGCTAGACCAAGGAGCCCTTTGGTGG
CCCTGTCTGGGCATAACAGAAGGCTCACACTCTTGTTTTCTGGTCACTTCTCACTATGTC
TCCTCAGCTCCTATCTCTGTATGGCCTGGTTTTTCCTAGGTTATGATTATAGAGCGAGGA
TTATTATAATATTGGAATAAAGAGTAATTGCTACAAACTACTGATTAATGATATATATAA
TCATATCTAAGATCTATATCTGGTATAACTATTCTTCTTTTATATTTTATTATACTGGAA
CAGCTCATGTCCTCGGTCTCTTGTGTCGGCACCTGGGTGGCTTGCCGCCCACACAACCAA
ATTAAAAAATAACACAGAAGGGTAAGGTAAGTCTCCATTAAACCCAGGAAAGAGACTGGA
AAACTCCTCTTTGGAGCCTGTCTATAGTCACAGGTGAAATAAAAGAAATAAAAGGAAAGA
AAAATGGGCAAAAGACTTGAATAGACCTTTCCCCAAAGAAGATATACAAATGGCCAAGAA
GCACATGAAAAGATGCTCAACATCATTAGTCATTAAGGAAATGCAAATCATAACCAAGTT
GATAAAATGCCACTTCACACCCACTAGGGTGGCTAAAATTAAAACAAACAAAAAGCCGAA
AATGAGCGTTGGTAAGGATGTGGAGAAATTGGAACCCTCGGATCTTGCTGGTGGGAATGT
AACATGCTACAGTTGCTGTGGAAAACAGTGGCAGTTCCTCAATAAGCTAAACATAAAATT
AGCATATGATTCAGCAATTTTACTCCTGGGTATATACCCAATACAACTGTAAACAGGTAT
TCAAACAAAAACTCATACACAAATGTTTATTTTTAGCAGCACTATTCACAATTGCCAAAA
GTAGAAACAACCCAAATGTCCATCAACCCATGAATGGGTAAACAAAATGTGGTATATTTA
CACAGTGGAATAGTATTAAGCAATAAAAAGGAATGAATGTATGCTACAACATAGATGAAC
CTTGAAACCATTAAGCTAAGTGATATAAACCAGATACAAAGGCCACATATTAGGTAATCC
TATTTATTTGAAATAACCAGAATAGACAAATCAATAGAGACAAAAAGCAGATTAGTGGAT
AAGTGATTGCCGGAAGTCTGGAGATTGAGGGAGAGGATGGAAAGTAACTAATGGGTTCAG
GGTTTCCTTTTGGGCAATGAAAATGTTCTAGAACTAGGTAGTGGTGATGGTTGCACAATA
CTGTGTATGTATTAATGTTATTAATAGTAAACTTTATGTTGTGTGTATTTTACTATTTTT
ATTTTTATTTATTTATTTTTTTGGAGACAGAGTCTCACTCTGTCTCCCAGGCCGGAGCGC
AGTGGCATGATCTTGGCTCACTGCAATCTCTGCCTCATGGGTTCAAGTGATTCTCCTGCC
TCAGCCTCCCAAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved