Homo_sapiens Locus Mono:54:AC016708.11
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:54:AC016708.11
Homo_sapiens
Mono:54:AC016708.11
2
SNORA70L6
1001..1135
2135
TGGTTAAAGTGATCTAGTTAGAAGTTAGTTAGATGGTTTCAGTTGGTTATGCATAAGTA
ATAGAATGTTCTTCTTATATATATATCTATCATATATACATGTGTATATAGGTATAAGTA
ATAGAATGTTCTAATGAGGACTTAGACTCATTATACCCACTGTGAGATAGACTTGAGATA
GGAAACCCATTTGTTACCTTGCCTCCATACAGCCACACTCTAACAGGGGCCATCATGACC
TTATGTGTCCTCCTAATGTCAGTGTCATCTTTTTCTCTATTTTCAGAAGCCCTTGAAAGA
TCTGTATTATCCTTTCTCCAGTGTACAGTTAATAAGATGAAAGGCCCAAGGTTCTTTTGA
TTAAGATTAGATGTTAGTTGACAGTTTCAGATTGGTTAAGAGTGTTTACACTGAAGTAGG
TTTTGGTTTGCTTAAGTGGGAATCCATGGTGCTGGAGCTGCCTCATTCTAATGGCCTCCC
AATTTCTTATTGGTGCTTCCACCTTCATTCATACATCATCATCTCTTGCCTGGATTATTG
CAATAACTTGGTAAATATTGTCCTTGTTTTTACCTTTATCCACTCTCTTGGTTTAGGTTC
CTCCAATAGCAGATCCTGAACAAGGATTTCAGTGTAACTTATTTAGGAGGTGATCTCAGG
GAGCATTGTAGAGAGTAGTGCAGAGATAGGAGTAAGGAGAAAAGCCCATTAAAGATTTAG
TGTTAATGAGGTGGTTACTATTGTAGACAGCCAGGCTCGATCTTGCTAGGGAACCTCTGA
GAGACTGAGTAGAACATGTCTCTGAATTGTGACACCAAGGGGCACAAGAAACTTGAGACA
GGGAACCCAAGTGATAGAATATCTCCCATATCTAAAGAGAACTGAAGCACTGTGCCTTTT
TCTTTAATATAGGAGGTGCATGGTGTAATAACTTGTCCTTTACATTGAAGGAATGTCCTA
GCTTGCCTCAAAACATGGACTATAAAAATGTCACTAATGTTCTGCAGCCAATTAAGCCAA
CTGAGTTCCTTTCCTTGTGGGGGCCCAGTGTGCAATGGCTGCACACAGCAGCTTCCTTGG
TAGTGTACACAGCCTGTTGGTTGTATGGGTTGCTCTGAGGGACCTTGGAGACAGGCCTTT
CCAATGGATGTTCATGTTTCTGACCTTGCGCTACCCCAATGTAGGCTCCAAACAGGCATG
CGAGGTGCCTTTGGAATGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATC
ATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCC
AAGTTCAAGCTTCCTGGCCACCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAG
TTCAATGCTGATGAATTTGAAGACATGGTGGCTGAGAAGTGGCTCATCCCAGATGGCTGT
GGGGTCAAGTACATCCCCAATCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGA
GGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCAAA
AAAATGTCACTAATGTACCCTAAATTTTCTTTTTTATTTTTATTTTTTATTTATTTATTT
ATTTTTTTGAGATGGTGTCTTGCTCTTTTGCCCAGACTGGAGTGAAGTAGCATGATCTTG
GCTTACTGCAACCTCCACCCCCCAGGTTCACCCTGTGATTCTCCTGCCTCGCCCCCTGAG
TAGCTGGGATTACAGGTGCCCACCACCAGGCCTGGCTAATTTTTATATTTTTAGTAGAGA
CTAAATTTTCTATGGTTTATCCACCTTGCAGTTCACATATGGCTTGTCAGAACATCTGGA
GCATTTGCTACTTCATGCTCACTAGTTTGATTAATATAATGTCATTTAACTCGTGGACCA
GCAGATTCTGTGCAGTGTCCCTTTAGACTCTATTGCAACAGAAAGCAGCAGAGTTAACAT
AGACCTGGGGCAACTCTCTGAACTTGCACTGCTGTCCAATCAGGTAAATGCTAAGGGCTT
TCAGTCCTTTCTCCTGATAACAACTTTAAAAAATTCATTTTCCAGTTTCATAGCAGCTGT
GTTGATTTGTTCTGTTAGCAGTACTACATACAACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved