Homo_sapiens Locus Mono:300:AC021733.12
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:300:AC021733.12
Homo_sapiens
Mono:300:AC021733.12
8
SNORA32L2
1001..1122
2122
ATTCATATCTTAAAAATCCAATTTCTACTTTATTACATACAAAAAAATAAATTTCAGGT
TGATGAAAAACTAAAATATGAAAGGCACTGATATGGTTTGGCTCTGTGTCTCCACCCAAA
CCTAATATCAAATTGTAATCCCCACATGTTGGAGGAAGGTCCTGGTGGGAGATGATTGGA
TTATGGGGGTGGATTTCTTCCTTGCTGTTCTTGTGATAGTGAGTGAGTTCTCACAAGAGC
TGATGGTTTTAATGTGTGCCACTACCTGCCCCACTCCTGCCACCATGTAAGATGTACTTT
GCTTCCCTTTCACCTTCCGCCATGATTATAAGTTTCCTGAGGCCCCCCAAGCCATGCAGA
ACTGTGATTCAATTAAACCTCTTTTCTTTATAAATGACCAAATCTCAGGTAGTTTTTCAT
AGCAGTGTGAAAATGAAGTAATAACAGTCACTACTTAAGAAACTTTAGAAAGAAAACAGC
TTTATAAATTGTAGATACGAGATACAAGAAATCACAAGCTACACGGATTAATTGATTTGT
CACAATAAACTTTAAAATACATTTTCAAAAAAATAGAAAACAAAAGCATAAATAAAAAGA
CAAGCCCAAGACTTGGAAAAGATACATTTAATGCATGTATCCAAAAAACTGAGTATTTAA
AATATATAAAGAACTCACACACACACACACGCACGCACACAGACACAATCAATAACAAAA
TAATCAATAGAAAAGTAGTCAAAAGATATGAGCAGAAAATCCATAAGAAAATCTGAATCG
CTAATATAAACATTTGAAAAACACTTTAAACTTCAATGAAATGAACAATTTAAGCAATTA
GATATTATTTCACACTCATCAGATTGGCCAAACTATAAAACAATGACAGTGCCCACTGCA
AAGAGGTAAAGCAGTGTTTCCCAAGCTGGACACTTGTCACTGGGGGCCAGATAATTCTGT
AGTGTGGTGGATGTCCCGCACATTGTAGGATGTTTAGCAAATGGTAATTACCAAGATTTT
TAGAATGCAGTTTCTCATTTGCCAGGGAAATGACCATAAAATAATTTCCCACTAGATTTT
TTTATCTGTTACCTTGCTAGCAAGCAGTCTATTGGGAACATTTTATTAACCCTTTATTAA
ACTGCTACTTGTTTTGCTTCCATTACCTAGATGAGCAGTATCCAATAGAAATACAACACA
AGCCACAGGTGATTTTCTAATAGCTATTTCATTGATAATCAATGAGATTTTACAACAGCT
GCATTTCAAATTCTCCCTGACAAGACTACGTGCATAGATCTCTTGAGCCTTGCAAATGTG
CTTTGCCTGGTGAATACACATTGTAACCCTTCTGGGTTGCTAATAACCAAGTGGTTTGTA
TATAGTGGAGCTAACTTAGGGAGGCTGGTTCCAAGACTCATTCATATTCATTATATGAAC
ATCTCTGGAAATGTAAACTTATGTTTATATGATTGTTATCTAGAAATTTAAAAAGAAAGA
AAAGGATGTTTAGCAGTATATTCCTTGCCTTTTCCCACTAGATGTCAATAGAATGACCCC
ACCCCCACTGGTTGTGACAACTTAAAATATCTCTACACATTACCAAATGTCACCTAGAGG
GCAAAATCACCCCCCACCTCCATTGAGAAGCACCAGTGTCAAACACTGCTGGTGAAAGTG
TAAATTGTTACAATTTTCAGAAGTAAACTGGCAATAACTAGTAAAACTGAAGAGGTACAG
AATCTATGATCAAATAAGGTATTTTTAATTCTATAGCTTGGAGAAATCTCACCTAAGTGC
TCCAAAAGACATGTCCAAAAATGTTGCAGCATTGATTGACTATTGAAAATTTGAGAACAA
TCTAAATATTGATCAAGGAGAATAGAGAAACTGTGCGAAATTCTTCAATGCAATACTATG
CAAAATAAAACAAAACACAAATAACAACAATAATTATCAACATAGTTAAACTTCACAAAC
ATAACATGAAACGGGAAAATGTTACAGTAGGACAGATAGATGATGCCATTAATGGAAAGC
TTGAAAACATGAAATACAATTTCACGTATTGTTTATGGATGCATATACATGTAGTAAGTC
ACGGTTGATGGCAGGTGATATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved