Homo_sapiens Locus GAS5
snOPY snoRNA Orthological Gene Database
Homo_sapiens GAS5
Homo_sapiens
GAS5
1
SNORD74, SNORD75, SNORD76, SNORD77, SNORD44, SNORD78, SNORD79, SNORD80, SNORD47, SNORD81
1001..1080, 1813..1872, 2036..2117, 2383..2450, 2723..2783, 3065..3129, 3324..3398, 3843..3924, 4306..4382, 4529..4605
5605
AGAACTAGGAAGGGGGCGGCGCCCAGGGACCGGCTCCAGGCGGCGGCGGGCGGGGAGCT
GCCAGGAGGTGGGTGTGCGTATCTGGGTGTGTCCCGGCTGCGGTGGGGGAGGGGGCCGCC
CTTCCCGGGGTCCTGAGGGAGGGGCCCCGCGAGGGGGCGGGTCCGGCAGATCAGCCCGGC
CGGGGGCCAAGGGGGTGGAAGGTCGCCCGGTGCCTGGAGGCGGGGTGAAGGAAAGTAGCT
GAGCGCCCCAGGAGCGCGCTGCGGCGGAGGGCGGGCGAGGTGACCCCGGTGCAGGGAAGT
GGCACTGGGGTGTGGGGCCCGAGTCCAGTCAAGGAGCAGCACCTACCTCCGGGGGTGGAA
ATGGGCCGGAATGGGCCGGAACACCGTCCCGGAAGTGAAATCCCCCACCCCCTCCCACGG
AGCGGGCGACGTGCCGGAAGGAAATCACTCAGCCTTACACCGCCCCCCCTTCCCCCATCC
CCAGAGCTTTCCTTGCCTCGCGCCCCCTCCCCTCTCTGCTCTTCCTCCTCAGTCGGGAGG
AGGGCGGGAGCACGGCATCACGTGGACGGTCATGTCTCTGCCCACAATGGCGAGGAAGGG
CGGGGAAAAGGGGCGGACTTAAGGGGTGGGAAGAAGGTGATACTGGATGAGAGGAAGATT
GAGGGAGGTTAGGGGGAGGAGCCGAAGCGGACGCTGCCGGGAGCGTGCGTCGTGACGTCA
TCAAAAGAACTCTTATATACAGGAGCCCAGGCACCATACTGTCTTTTCGAGGTAGGAGTC
GACTCCTGTGAGGTATGTTTTATCTTTGCGAATGTTGCGGGTTTTGGGGCGCTCCAGCCT
TTGTCTGCTAAGGTCACCCTGAATTGACTGGGACTTCTAAGCCAGTCGCGCGCCTTTGCA
GGGCCTACAAGTTGAGGATGGTGGGGGATTGCACATATGGTGCATGCGTGACCTAAGCTG
CGACTATGTTAGAGTAGAACTGCGGAGAAGCCTCGGCTCTCGTGCCCTGCCTCTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGAGTAATGATGAATGCCAACCGCTCTGATGGTGGCA
CATGCCGAGTCACCCGAGTAAGCTATTGTTAAGGGCCGTGACCCGAGCCTCCATCAGCCG
TCCGCTCTCATGAAAGGCTGTCGGTGGTAGTCCACGTGCTTAAGTGCCTGCATTCCGCAG
TGTCACCAATATTTCCATTAGTGTTTCTTTTTTCTTTTTTGAGACCGAGCCTCGTTCTGT
CACCCAGGCTGGAATGCAGTGGCTCGACATCGGTTAATGGCAACCTCCGCGTCCCGAGTT
AAGCAGTTCTGCCTCAGCCTCCCAAGTAACTGGGACTACAGGCGCGCGCCACCATGCTAG
GCTTTTATATTTTTAGTAGAGACGGGGTTTCACCATGTTGGCGAGACTGGTCTTGAACTC
CTGACCTCAGGTGATCCACCAGCCGTGGTCCCCCAACATACTGGGATTACAAGCCGTGAG
CCACCGCGCCCGGCCGCCATCGGTGGTTCTTAACTGCGGGTGCAGTGCTTCTTTGTAACA
TTAAGTGTATCCTTTACCTGTCGCTAGATAATGAATGGTATGTTACCTGCATCATTGGTT
TAAAAAGACGAACCGTTTTTTTAAAGAACACTCTTTAAAAAAAAGAACCGTGGAACAATG
AATTAAAATCTGTACCTGATCTCTTTAGGTATGGTGCTGGGTGCAGATGCAGTGTGGCTC
TGGATAGCACCTTATGGACAGGTAAGAATTGGGGAAAGTATGGTGGGAAGAATGAAATCT
AAGAGGTGGTCTCAGCCTGTGATGCTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAATT
CTATTCTGAGGCTTTAATGTTAACAGCATTTATATTTAACGTGACTGCTGTGAGGTTCAT
TCTCACTGTTTTGCTTGCATCTTTTTGTTTTCTAGTTGTGTCCCCAAGGAAGGATGAGAA
TAGCTACTGAAGTAAGTTGAAAATTCCCTCTCAAAAAGGTTTAAAGCCATTGGATGTGCC
ACAATGATGACAGTTTATTTGCTACTCTTGAGTGCTAGAATGATGAGGATCTTAACCACC
ATTATCTTAACTGAGGCACCCAAAATGGTGAGTTGGGGAACATAGAGAGTACACCTAAGT
TCACATGAAGTTGTTTCTTCCCAGGTCCTAAAGAGCAAGCCTAACTCAAGCCATTGGCAC
ACAGGTGAGACACCTCTATTTTGTACTTCTCACTTTTAAGGGATTAGAAAATAGCCAAAG
CAATGATGATTATCTATGTTAGTGCTTCTCTCCCCTCTTTTCAAATGAGAATTTTGCTCT
CATATTGATACTAAGTTTAATACTGAAGAAAATGTGAAAACAGATACTATGATGGTTGCA
TAGTTCAGCAGATTTAATCATGAAGAGATGTACTATCTGTCTGATGTATCTGGGGTAGTT
GTGGTTTGCTGTTAATGGTTAAGCAGTGTACCACCAATCTACCATTAAAATATTTTTTGC
TGACAATTTTGTATTAAAATTACAGGCATTAGACAGAAAGCTGGAAGTTGAAATGGTAAG
TGAAACTGTATCCAAGTAAGCAGGTAACTGGGCAAACTTCCTACGGCACAAATGGCTTTT
TAGTTACCTCCTAGTGCTGAATGCATTAAATAAATGGCGGATTCTTGTCTTGTTATGATT
AATAAGAAAGTTTGTAAATGCAGCCTGGATGATGATAAGCAAATGCTGACTGAACATGAA
GGTCTTAATTAGCTCTAACTGACTAAAGGCATTTGTTAGTTTTGGCAGGGGGTGAACACT
CATCTGTGGCTATTCTAAGACCACTCTTATTTCTTAGGTGGAGTCCAACTTGCCTGGACC
AGCTTAATGGTTCTGGTAAGTATTAATGAAAACAGTAGATAGACTTAATGAAAATGCTGA
TGGTGATATGCTTACTGCTGAGCTAATGGCTTAAGGCTTGGCTGATGAATACTGACTGTA
TTTTCCTTGAGCATGTCTGGAACAGTGTTTATGTGTTTTCCTTGAGCATGTTTGGAACGG
GGTTTGTGTAATGATGTTGATCAAATGTCTGACCTGAAATGAGCATGTAGACAAAGGTAA
CACTGAAGAACCCTGTGACAGACAACTTTGAAAAGAGTTTAATGATGTTTAGCATTTTAA
TGGAAGTCCTCATTTGTATTCCAGCTCCTGGTAACGTTTTTATCCATGGATGACTTGCTT
GGGTAAGGACATGAAGACAGTTCCTGTCATACCTTTTAAAGGTACATGTTTTATTGATGT
TAACGTTAATTGATTGAGCTACTGTTAGTGATGATTTTAAAATTAAAGCAGATGGGAATC
TCTCTGAGAAAGAAAATGGAGATTAATCTTAAACTGAAACAGTAGTTGGGAAATCTTTTA
GAAATCCACCTATTACTACCTATTGGTAAAGGAGATTAAATTTCTACAGGTATGGAGAGT
CGGCTTGACTACACTGTGTGGAGCAAGTTTTAAAGAAGCAAAGGTATAGCAGTTCCAAGT
ATTTTTTTTTTTTTTTTAGACAAGAGTCTAGCTCTTGCCCAGAATGGAGTGCAGCGGCAC
TATCAGTTCACTGCAACCTCTGCCTCCCAGGTTCAAGGAATTCTCCTGCCTCAGCCTCTT
GAGTAGCTGGGATTACAGGCATGTGACACCATGCCTGGCTAATTTTGTACAGCTATGTTG
TCCAGGCTGGTCTCGAACTCTTGACCTCAAGTGATACTGCCCGCACTGACCTCCCAAAGT
GCTGGGATTACAGGCGTGAGCCACCATGCCCCGCCTCAAGTCTGGTTTTTAAGTGTTGTA
AAGCCGATACAATGATGATAACATAGTTCAGCAGACTAACGCTGATGAGCAATATTAAGT
CTTTCGCTCCTATCTGATGTATCTGGCGGTAACATTCTAGTTTATGCCCCGAAAAGGGGA
ATATAGCCATTCTATAATGTTTGGAGATTTTGGATTACTCCTAATTGTATGCAAGTTGTC
TTACTGTGTATTGTCCCTTAATTTCAGGACTCAGAATTCATGATTGAAGAAATGCAGGTT
AGTTTAAACTTTGAAGGAAATTTTTAAGGTGGCAAAAGGTTTTGGTGGCATATACACCTT
AATCTGTAGATGGGAGTGATTAGCTGTTTAAAAGTTAAAATGTGACTGAGAAGGAAATTG
AGTAGGGCAAATTTTAAATGGGTATTATTTTTCATCTTCAAACAGGCAGACCTGTTATCC
TAAACTAGGTGAGTCAGCTTTTGGTACATGTGATGATTTTCAGTGTAACCAATGATGTAA
TGATTCTGCCAAATGAAATATAATGATATCACTGTAAAACCGTTCCATTTTGATTCTGAG
GTTACTCTACTAACAAGCATCACACATTTGTATTTTGCCCTGATTAATATGTTGGCTTCG
CTTTCAGGGTTTTTAATGACCACAACAAGCAAGCATGCAGCTTACTGCTTGAAAGGTGAG
GATTGGAAATGTTGGGACTATTATAATTGCAGAATACATGATGATCTCAATCCAACTTGA
ACTCTCTCACTGATTACTTGATGACAATAAAATATCTGATATTCTGCATTCCCATGTAGC
ATTTTAATTGAAGTCTGTAAATGTGGCTAAAAGTCTTGTCTTATTTTTTGAGACAGGGTC
TTGCCTCACCCAAGCTAGAGTGCAGTGGCCTTTGAAGCTTACTACAGCCTCAAACTTCTG
GGCTCAAGTGATCCTCAGCCTCCCAGTGGTCTTTGTAGACTGCCTGATGGAGTCTCATGG
CACAAGAAGATTAAAACAGTGTCTCCAATTTTAATAAATTTTTGCAATCCATCTGGAGTG
TGTAGTGTTTACTTAAAAAAGGACAGTGCTTTTCATCTGTTCATTAGCTGTAAGCATAAA
TCACATTCAAAAGCTATTATAACTCCATGGTATTTGCTTCATTAACACTGCAGCCAGTTA
AAATTTTATGGGTATTTTACAAGGTGTCTTATGCATTAAAGTGCAATATTTCCTAATTCT
CCATATGAGCAAATTGTCAGGTTTCATAGGCCCCTGTGCTAATTGGTTTTGAGCTTAAAG
TATTGATGGAGCTACTTGGAGAAAGTCATGTTGAGTCTGAGGCTGGGAAAATAAGTTATA
GAAAATACTATAGAAATGCCCAACTAGTGATAGGCATTAATGGAATTGGGAAAATCTACA
ATCCATAGCCATGGTGATAGGTTTTTGGCAAGCACTAAGTGTTTAGGGATGCCAAAAGTG
GGTATAAAGGGCACAACTGGTTTAAGGCAATCTGTCCCAGGGAAACAGGACCAAGGGGCC
AAAATTCCAAGATGGGTCAAATTTTAATTTCAGTGTCAGTACAGCTGTGCTTATAATGAT
GTCTTTGTTAGCAGTAATGGTTTTACAAATCTGTTTCTGGGCTAAAGCACTTTAGTCCCA
TTAATGATAAAACTTCAGTTACTCTCTGAATTTTCCTTTTTTTGAGACTGAATCCTGTTG
CCCAGGCTGGAGTGCAATGGCATGATCTCAACCGCTGCTCACTGCAACCTCTACCTCCCG
GGTTCAAGCGATTCTCTTCAGCCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
758..791, 1708..1760, 1955..1990, 2184..2223, 2545..2574, 2857..2894, 3204..3280, 3469..3522, 4047..4076, 4245..4267, 4447..4494, 4676..4850
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved