Homo_sapiens Locus Mono:234:AC092015.2
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:234:AC092015.2
Homo_sapiens
Mono:234:AC092015.2
1
2209
AGCTATAATATTTGCCAGAAATTTTACTTTTAAAATTGGTAATATCACTTTTTGTAGCT
TATAGTGACATGAGAGATAGGCTAATAGAAATGAATAATCCAAGTTTGTAGTTTAGCAAA
ATGAAGCTTAGGTAGTTAAAATTAACATTCAATTTGAAATTCATGTTCAATTGACATACA
ACTCATTTCATTACATTTACTAATCATGATTTTCATAAAAGTTAAATCAGTTAACTTTTA
AATTATGTTCAAACAATAATCTACTAATTAAGTTGTTAATGTTTTAAAGAGAGGCATGGA
TTTATTTTTGATTTTTAAAATAACATCTTTAAGCCAATACTTATGTTAATTCCCAGTTCA
GTTTCTTCTAAAATATTTCCACTCTGATAACAAATTGGGGCATACAAATTTGGTAAGATT
ATTTTTTATTTTTAAAAACTTAAATGTGAAATGGTGTGATTTATATTAATAAAGAAATAC
CAGTTAAAATGTAATTTTTCATTGGTACACATAGTAGCTAGTTTATTTTATTTTTGTTTT
TTTCAAGACGGATTCTTGCTCTGTCATACAGGCTGGAGAGCAGTGGCACAATCTTAGCTC
ACTGCAACCTCCGCCTCCTGGGTTCAAGCAATTCTCCTACCTCAGCCTCCTGAGTAGCTG
GGATTACAGGTGCCCAACACCATACCTGGTTAATTCTTGTATTTTTAGTAGAGATGGGGT
TTCACCATGTTGGTCAGGCTGGTCTCAAACTCCTGACCTTGTGATCCGCCCACCTCGGCC
TCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTGTGTCCGGCCCAGTAGCTAGTTTATT
TTTAATCACATTAAAATAGCATTTAAATGATATATATTTAAATTAATCTTAAAACAACCA
TCCTGATATACCTAGGACCTACCTACATTTTAGTTACATCTTAATTATCAACCAGATCAA
ATATAAGTTATCTGTCTTTGTGGAATCAATAAAACTATGCTAAGACTATACTTTCAGGGA
TTATTTCAGATAAACTTCTAGAGTTTCTCTGAACCTGTAGAGCACCAGAAACCATGAAAA
GAGGGTGTAGCATTCTCTCCTGCGTGTGAGGCCGGCTCTTGGTGCTACCTCACTGAAACT
GCCATTGCCACGGATGATCATTCTTCTCTTACTCTGAGAGAGAAAGAGAGAGAGAATACA
GTCTGAGTGGTTCTCATTTTTTTTTTTTTTATTTGAGACGGAGTCTCGCTCTGTTGCCCA
GGCTGGAGTGCAGTGGCATAATCTTGGCTCACTGCAAGCTCCATCTCCCAGGTTCACGCC
ATTCTCCTGCCTCAGCCTCCCGAGTAGATGGGACTACAGGCGCCCACGACCACGCCCAGC
TAATTTTTTGTAGTTTTAGTAGAGACGGCATTTCACCGTGTTAGCCAGGATGGTCTCAAT
CTCCTGACCACGTGATCCACCTGCCTCAGCCTCCCAAAGTGCTGGGATTACTGGTGTGAG
CCACCGCGCCCTGCCTGAGTGGTTTTTATTTTAAAAATAAAATTAAATAAGTAAATAAAT
AAAACTTTTTGTCTACTTTATAGAAAATCTAGTTCTATTGACAAATTCATACCTATATCT
TTAATATACATACACATATCCACATATGCATACACACACACGCACACACACACACCCCAC
ACACACCAATTAGTAAAACTCAAGAGACTGTTGCTTTCTCAATGGTTTATACTCAATATT
CCCTAATCAAGTGAGGCTTTGGCATAAAGCACGAATCTCAAGATATCATTCCAAAATATG
CAGGAAAACAATAAGAAAATAGGTATGTAAATATTTATTTACCTAAATATGTAAATATTT
ATATTTATTATAAAGCTGCTTAAATATTGAAACCTCAGAATTTTGTGCTATAAAGTACAG
AAAAGGTAGTTAACCATGTATTCTTGTTGTTTATTTTAACGCATTCCTTCATTCTCTGGA
CTATATTTTTGAGCAGTTTTTGTGGTTGTCAACTGATAAATTGTATTAAACTTCATAGGT
ATCAGAATGTCAACTTAGCCATTTCCAGAATTTTTAGATCAGCTCACTTTTTGAAAAGGC
TCTGTAGCTATTGCCCCATAATTGGTTGTTTCGAAAGGATTCCAGAAGTCACTCTCTTAG
TTTGCTTGGACTGCTGTAACAAAATATATTAGACTGGGTAATTTATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved