Homo_sapiens Locus Mono:118:AC107393.4
snOPY snoRNA Orthological Gene Database
Homo_sapiens Mono:118:AC107393.4
Homo_sapiens
Mono:118:AC107393.4
4
SNORA70EL2
1001..1110
2110
TAATCAATTTAATGCTGACTAGATCCTATAACTACATTCTGCTTTTTATAACTAAAGAG
CTCCAGAAAAATAAATGTAATAGCTTTGCTGGAAAAGATTAACTTTACAATGCCTTCCTA
ATGACCTTACTTTTTTTTTTTTTGAAAAGTATTTTCTGGTATACAAAAATAATATTCTGA
AATATCTCTGTGATATTTGATTGCCGGATTTAACCTACATACCTCTGAACCTTGGTTTTT
CAGACATACAAACTGCTTAACAAGTTCCAATGCATTAATCAATACACCATTGCATAACTT
AGAGTAAGAAAAGTTGGTAGATATTTCAGCAATGCCCTAAAATATGCTTCTATTTAACAC
TTTGAGACAACCAATACACTATTTATAGTGTTGAGACAAAACAAACCTAAGATCACAGAA
AAATATTTATTTTAATAAAATGGTATTTAAGTAGATAGTTTTTTGTTGTGGTTTTTTTTT
TTTTTTTTTGAGATGGAGTCTCCCTCTGTCGCCCAGTTCAGTGGCCCAGTCTTGGCTCAC
CGTAACCTCCCCTTCCCGAGTTCAAGCAGTTCTCCCTGCCTCAGCTTCCTGAGTAGCTGA
AATTACAGGCATGCACCACCACGCCTGTTTAATTTTTGTGTTTTTAGTAAAGATGGGATG
TCATTATGTTGTCCAGGCTGGTCTTGAACTCCTGACCTCAGGTGATCTGCCCACCTTGGC
CTCCCAAAGTGTAAGTAGATAGTTTAAATGATTATGGGTTTCATAGGTTTTATTAATTTG
TTTTAGTTAACATACAAGAGCACTACAAAACCACATGATTTTATTTTAATTTTTGTCAAT
AAACTTTATTATATTAAAGGCCATATTGCCCACTGAGTATGATTTTGATATGCACAACTT
CTATAATTTACAACTTACTGTATATGGTCTAATATAAATTACATTTAGCTATCTTGAATA
AAAGATACTACTCCCCAAAAACTTAATATATAAAATAATTTCTACAATCAATTAAGCCAC
ACAGCTCTTTTTCTCATGGGGCCTGGTGTGCAAGGGCTGCAAACAGCAGCATCCTAGGTA
GTGTACAGCAGCCTGTTCCTTGTGTACAACAGCCATTGGACATTTATGTCTCGGATCTAG
TGCTTTCCCTAGTCTAGGTTTAAGACCGGATGTAGTATGCCTTTGGAAAGCCTCAGGACC
CAGAGGTCAGAGTTCACATTGGCCATGTTCATCCATACCAAGGATGAACTTATTTAGGGC
CAAGTTCAAGTTCAGTGAATGCCCAAAAAGCCACATCTCAAAGAAGTGCAATTTTACTAA
GTTTAATGCATATACATTTTAAGACTTGGTGGCTGAGAAACAACTCATCCTGGATGGCTG
TGGGGCTAGATATAGCCCTGGAATCATGGGCCCCTGGACAAGCAGCTAGCCCTGCATTAG
AAAAGAGCTGCCCCCTCTTTACTCAGCCCACCAGTGAATTCTATTTCCTGTACATCTAAT
AAATCAATCCTATCTATCTATCTATCTATCTAAATAATTCAACAATATGAAGTAGATTAA
AAAACACAACTTTATCTTGATGTCTAACTACTGTGGAAATATTTTGTCAGTTATTAACAT
TCCCCTTTCAGGTTAATATCAAGTCAACAAAAATTTGGAGTTCTCTTGACCCTTTCCCCA
ATGTGTAAATTAGTAATATAATGTCAATATTCAGACAGGCAAATAAACTAAGCTCCCTTT
GATGAAAACGACATGCAGTAACGCTTCCCTACTGAGAATCATCTTAGTTTGTGAAATCAT
AATCTGGAATGGCTATATCTGCAAAATATATTAAAAGAAAGAAAATATCAAAAACATAAT
CTACAATACTTTTATGTATATCTAATCATTTTATATTTCTTTTTTATTATACTACTTGAA
ATACATACATAAAGGATAAAGAGTTTCAACAAATCTCAAAAAGGAAACCTAATTATGTAT
AATATTCTGACCGATTTTGCTTGCTCACCAAATTGAAATTGAAAAGAAAAAATGCAGCAC
TCTGTAAAAAAATAAAATGATTTCAAAATATAATTATTGTCTCCCTTTGAAAATATAAAT
GTTTAAATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved